Labshake search
Citations for Promega :
51 - 100 of 5137 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blots were incubated with relevant primary and HRP-conjugated (Promega) secondary antibodies and were detected using Clarity ECL reagent (Biorad ...
-
bioRxiv - Cell Biology 2020Quote: ... we used the primary antibody (anti-HaloTag pAB, Promega 6928) and secondary antibody (anti-rabbit HRP ...
-
bioRxiv - Immunology 2021Quote: ... Primary antibodies used were as follows: anti-luciferase (G7451, Promega), CD45 (Tonbo Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies include anti-NLuc rabbit polyclonal (1:6,000) (Promega), anti-mCherry rabbit polyclonal (1:5,000 ...
-
bioRxiv - Systems Biology 2023Quote: ... Peptide loading was assessed by comparing the intensity of the total ion current to 200 ng of a human K562 whole cell lysate standard (Promega, Madison, Wisconsin, USA) prepared at 0.2 μg/μL.
-
bioRxiv - Cancer Biology 2021Quote: ... and human Renilla luciferase (pGL4.74[hRluc/TK], Promega, E6921) were used in the study ...
-
bioRxiv - Microbiology 2020Quote: ... insert (NRP1, native human ORF in pF1K, FXC23812, Promega): 5’-atagggcgaattcggtagtaaggagcgatcgc-3’ (fwd ...
-
bioRxiv - Cancer Biology 2022Quote: ... were amplified by PCR from human genomic DNA (Promega), using the primers listed in Table S1 and then inserted into the psiCHECK-2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... human GR and MR were cloned into pACT (Promega) as N-terminal VP16 fusions using HiFi assembly (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunofluorescence utilizing primary antibodies directed against βIII-tubulin (1:1000, Promega) and secondary antibodies Alexa Fluor-488 (1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used were anti-p75NTR (Promega, Cat: G323A, 1:300) and anti-GAPDH (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... The following primary antibodies were used: NanoLuc (N7000, Promega, 1:1000), β-ACTIN (#4970S ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Microbiology 2020Quote: ... The human codon-optimized NanoLuc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Immunology 2020Quote: ... The human codon-optimized nanoluc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Serial dilutions of genomic DNA from human placenta (G1471, Promega) were used as a standard for quantification and their concentration.
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Neuroscience 2024Quote: Human male genomic DNA obtained from Promega (Ref:G1471; Madison, WI) was used to generate the input library ...