Labshake search
Citations for Promega :
151 - 200 of 6273 citations for Mouse Calcitonin Gene Related Peptide Type 1 Receptor CALCRL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and Kcan1 genes in a pGL4.11 plasmid (Promega) by Gibson assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... other cell types were transfected using Fugene HD (Promega) or Lipofectamine 2000 (Life technologies ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cell Biology 2020Quote: Genomic GNA (gDNA) was extracted from each of the GFP+ and GFP-cell types using the Wizard Genomic DNA Purification Kit (Promega, Southampton, UK) and quantified using a Nanodrop 1000 Spectrophotometer (Thermo Fischer Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Enzymatic activities of KARS wild-type and mutants were determined by measuring AMP production and ATP consumption with AMP-Glo Assay Kit (Cat#V5011, Promega, Madison, USA) and ATP Bioluminescent Assay Kit (Cat#FLAA ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from mouse tail using genomic DNA extraction kit (Promega Wizard SV Genomic DNA Purification System ...
-
bioRxiv - Immunology 2019Quote: ... 0.4 μg envelope vector (pMD2.G) and 1.6 μg hairpin-pLKO.1 vector (SHC016 control or gene specific shRNA. Fugene-6 (Promega) was used as transfection reagent ...
-
bioRxiv - Immunology 2019Quote: ... 0.4 µg envelope vector (pMD2.G) and 1.6 µg hairpin-pLKO.1 vector (SHC016 control or gene specific shRNA. Fugene-6 (Promega) was used as transfection reagent ...
-
bioRxiv - Microbiology 2022Quote: ... Both cassettes were built by first cloning the wild-type locus and 1 kb flanking region in the pGEM-T plasmid (Promega) and subsequently modifying the plasmid to add the HA-tag coding sequence using the Q5 Site-Directed Mutagenesis kit (NEB ...
-
bioRxiv - Plant Biology 2019Quote: ... regions of 150 bp to 300 bp were amplified from the plasmids using gene specific primers (Supplementary Table 4) and the amplicons were labeled by random priming (Prime-a-Gene® Labeling System, Promega). U6 was monitored as an equal loading control.
-
bioRxiv - Cell Biology 2020Quote: ... The partial frame of circ_0005962 containing the binding site or mutant binding site (wild-type or mutant-type) with miR-382-5p was amplified and cloned into the downstream of pGL4 vector (Promega, Madison, WI, USA) to generate circ_0005962-wt and circ_0005962-mut fusion plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with the same enzymes and ligated with the amplified receptors using T4 DNA ligase (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5000, 1:10000 or 1:20000; Promega) was used as secondary antibody ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit and mouse anti-βgal 1:500 (Cappel, Promega, Abcam), mouse anti acetylated tubulin 1:100 (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... from Santa Cruz Biotechnology, mouse anti-β-Galactosidase (Z378A, 1:500) from Promega, mouse anti-MYC tag (#2276 ...
-
bioRxiv - Biochemistry 2020Quote: ... HRP-conjugated anti-mouse IgG (Promega, WI; 1:3000-5000), HRP-conjugated anti-rabbit IgG (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... or anti-mouse IgG-HRP conjugate (1:10,000; Promega W402B) by incubating membranes for 2 h at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... β III tubulin (anti-mouse, dilution 1:20,000, Promega, Madison, WI), and NR2B (anti-rabbit ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with mouse anti–βIII-tubulin (1:2000; Promega, G7121) overnight at 4ºC followed by incubation with secondary antibody (donkey anti-mouse Alexa-Fluor 488 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse mAB anti-β-Galactosidase antibody (Z378A, 1:500, Promega), pAb rabbit anti-active JNK (V7931 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and HaloTag (mouse monoclonal, Promega no. G9211; 1:1000 dilution). Membranes were incubated for one hour at room temperature with IRDye secondary antibodies (Goat anti-Mouse 680RD ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-β-galactosidase (Z378A from Promega, 1/1000). Secondary antibodies (anti-rabbit IgG-Alexa Fluor 633 and anti-mouse IgG-Alexa Fluor 488 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Zeev Paroush) and mouse anti-LacZ (1:1000, Promega z3781). Detection was performed using mainly goat anti-rabbit IgG H&L (DyLight® 488 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies were either goat anti-mouse IgG HRP or goat anti-mouse IgG HRP (Promega; 1:10,000) respectively.
-
bioRxiv - Biochemistry 2022Quote: ... Proteins/peptides were further digested with trypsin (Trypsin Gold, Promega) at 37 °C overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... genomic DNA from puromycin selected cells and wild-type HEK293 cells was extracted (Promega Wizard Genomic DNA Purification Kit #A1120; Promega, Madison, WI, USA) for PCR amplification of a 535 bp region flanking the sgRNA cleavage site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Luciferase reporter gene construction The pGL3 Basic vector (Promega) was used as a backbone ...
-
bioRxiv - Genomics 2021Quote: ... we amplified the Fluc reporter gene from pGL4.13 (Promega) using PCR primers WA1312 5’-AAAACCTAGGGGCCTGTCAGGCCATGGAAGATGCCAAAAACATTAAGAAG-3’ and WA1314
-
bioRxiv - Neuroscience 2024Quote: ... Amplification of genes utilized GoTaq qPCR Master Mix (Promega) as per the manufacturer’s protocol on the LightCycler® II 480 system machine (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... (ii) wild-type cells transfected with mEGFP using Fugene6 (Promega), (iii ...
-
bioRxiv - Molecular Biology 2023Quote: ... A polyclonal goat anti-mouse conjugated to horseradish peroxidase (1:5,000; 1:10,000; or 1:20,000; Promega, W4021) was used as the secondary antibody ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real time RT-PCR (qPCR) was performed using gene-specific primers (Supplemental Table 1) and the fluorescent dye SYBR Green (Promega). All quantifications were normalized to the TIP41 (AT4G34270 ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK-293 cells were transfected with FLAG-tagged receptor (3.5 μg) and luciferase-based 22F cAMP biosensor construct (3.5 μg) (Promega). 14–16 h post transfection ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: To measure ATP bound to detergent purified P2X1 receptor a Kinase-Glo® Luminescent Kinase Assay (ProMega, USA) was used ...
-
bioRxiv - Biochemistry 2019Quote: ... and HRP-conjugated rabbit anti-mouse antibody 1:10,000 (Promega, W4028). The plate was developed with 2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid ...
-
bioRxiv - Genomics 2019Quote: ... and anti-rabbit-HRP or anti-mouse-HRP 1:10000 (Promega). Blots were visualised with the Fusion Fx7 system and quantified with ImageJ 1.48k.
-
bioRxiv - Cancer Biology 2020Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Neuroscience 2021Quote: ... JF-549 or Halo-tag antibody (1:500, Promega, mouse monoclonal) and measuring the newly synthesized actin (in most cases ...
-
bioRxiv - Microbiology 2021Quote: ... and goat anti-mouse IgG-HRP (Promega W4021; 1:5,000 dilution).
-
bioRxiv - Microbiology 2020Quote: ... Secondary -mouse IgG-HRP conjugate (Promega, Mannheim, Germany; 1:4,000 dilution) was used for detection ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-β-galactosidase (1:1000, Z3783, Promega, Madison, WI, USA), rabbit anti-β-galactosidase (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-β-galactosidase (Z3781; Promega, Madison, WI; 1:200). Alexa Fluor 488-conjugated (A21206 ...
-
bioRxiv - Cell Biology 2022Quote: ... incubated with HRP-conjugated donkey anti-mouse IgG (1:10,000; Promega), and revealed with Super Signal chemiluminescent substrate reagents (Pierce ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Biochemistry 2024Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:3,000 Promega) was used as secondary antibody ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted from overnight bacteria cultures from resistant and wild type parental strains using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA), quantified and measured for DNA quality by Qubit High Sensitive dsDNA assay (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... ELISA plates were read on a GloMax plate reader (Promega, Wisconsin, US). Data were converted from concentration to total mass based on the volume of media/pellet ...
-
bioRxiv - Immunology 2021Quote: ... followed by three washes with TBS-T and 1 hr incubation in TBS-T + 1% milk + anti-mouse serum (1:10,000) (Promega). All steps were carried out at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Peptides were released by digestion with PNGase F (Promega, Madison, WI) overnight at 37 °C with vortexing ...