Labshake search
Citations for Promega :
451 - 500 of 6273 citations for Mouse Calcitonin Gene Related Peptide Type 1 Receptor CALCRL ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was isolated and the gene region of interest was amplified using GoTaq DNA polymerase (Promega) (HBB Fw ...
-
bioRxiv - Immunology 2022Quote: The protein sequences of the selected seven Listeria genes were cloned into a pGEM4z-plasmid vector (Promega) containing a T7 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... and NanoLuc luciferase reporter gene expression was detected using a Nano-Glo® Luciferase Assay System (Promega) and analyzed on a Infinite M200 plate-reader (Tecan).
-
bioRxiv - Biochemistry 2023Quote: ... synthetic gene fragments containing response elements were inserted into a pGL4.23[luc2/minP] vector obtained from Promega using KpnI and HindIII (for SRE ...
-
bioRxiv - Microbiology 2023Quote: ... lacusprofundi 16S rRNA genes followed by cloning of amplified products into a pGEM-T easy vector (Promega), transformation of JM109 competent cells (Promega) ...
-
bioRxiv - Genetics 2024Quote: ... were cloned upstream of a minimal promoter driven firefly luciferase reporter gene in the pGL4.23 vector (Promega). Existing plasmids constructs of variant-centered test elements for the five variants of interest (see Dataset S1 for genomic regions ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were subjected to three wash periods for 5 minutes in 1x TBS with 0.5% Tween and then probed with horseradish peroxidase–conjugated goat anti-mouse or goat anti-rabbit secondary antibodies at 1:2,500 (W4021, W4011, Promega) in 1x TBS with 5% nonfat dry milk and 0.5% Tween at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega) also used at a 1:10,000 dilution.
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Immunology 2019Quote: ... then washed three times in lysis buffer and two times in ammonium biocarbonate (50mM) before peptide digestion (V5280, Promega). Peptides were loaded onto a 3-cm self-packed C18 capillary pre-column (Reprosil 5 μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... EV protein samples were alkylated the next day with 50 mM iodoacetamide for 2 hours at ambient temperature in the dark and then digested into peptides with 1.2 µg proteomics-grade trypsin/LysC (Promega) according to the SP3 protocol described by Hughes et al (2019) ...
-
bioRxiv - Physiology 2022Quote: ... The proteins were cleaved into tryptic peptides by addition of 25 μl of a 0.2 μg/μl trypsin (Promega) in 50 mM ammonium bicarbonate and incubation (18 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality control of the instrument setup was monitored using the Promega 6x5 LC-MS/MS Peptide Reference Mix (Promega) and analyzed with the PReMiS software (version 1.0.5.1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat Gβ1 was fused with a His-tag at the N terminus and with a SmBiT subunit (peptide 86, Promega)34 after a 15-amino acid linker at its C terminus ...
-
bioRxiv - Biochemistry 2023Quote: Serine/threonine phosphatase activity assay of PP2A was performed using the artificial p-peptides RRA(pT)VA substrate (Promega) in lysis buffer containing 1 mM MnCl2 at 70 °C 26 ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... Cells were transfected 24 h later with 2.5 µg of pRP-PPARG2 wild-type or mutated vector (Vector Builder) in the presence of Fugene HD transection reagent according to manufacturer’s instructions (Promega). The cells were selected 24h after transfection with 4µg/mL of puromycin for 24h ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... These cells were transfected 24 h later with 2.5 µg of pcDNA3-PPARγ2 (wild-type or mutated) in the presence of the Fugene HD transfection reagent (Promega). PPARγ2 transient overexpression in the UMUC3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Plant Biology 2020Quote: ... The Wpgd1 and Wpgd2 fusion genes as well as Pgd1 and Pgd3 ORFs were cloned in pGEM3Z (Promega). Chloroplast import assays were performed essentially as described by (54) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The dsRNAs of the TRP and TRPR genes were prepared using the T7 RiboMAX Express RNAi system (Promega). The primers used are listed in Table S11 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the 82-nt exon 11 of the MAPT gene was constructed in the pCI-neo vector (Promega).
-
bioRxiv - Immunology 2020Quote: ... The cells were collected and assayed for reporter gene activities using the Dual-luciferase reporter assay system (Promega). The firefly/renilla luciferase ratios were calculated to determine luciferase activities ...
-
bioRxiv - Systems Biology 2020Quote: Renilla control plasmid (3630 bp) was derived from another commercial vector pGL4.70 with the hRluc renilla gene (Promega) by insertion of a moderate-strength P transposase (pTran ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pAMD375 was constructed using oligonucleotides JW10881 and JW10882 to amplify the NanoLuc luciferase gene from pNL1.1 (Promega). The resulting DNA fragment was cloned into pAMD001 (40 ...
-
bioRxiv - Plant Biology 2021Quote: ... on CDSs of the target genes cloned into the pGEM®-T Easy vector (Promega, Madison, Wisconsin, US). Oligonucleotides and construct IDs are listed in Table S6 ...
-
bioRxiv - Genomics 2021Quote: ... either an oligo(dT)15 primer or a gene-specific primer were used with ImPromII Reverse Transcriptase (Promega). All primers used in RT-qPCR were listed in Supplemental Table 4.
-
bioRxiv - Genetics 2020Quote: ... was cloned into upstream of the firefly (Photinus pyrails) luciferase gene in pGL4.23 vector (GenBank Accession Number DQ904455.1, Promega) and verified that it has constitutive activity but is not hyperosmotically inducible ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the housekeeper gene Hprt (ID: Mm03024075_m1) using GoTaq Probe qPCR and RT-qPCR System (Promega, Madison, WI) and Quantstudio 7 flex RT-PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... the Renilla luciferase (Rluc) gene was PCR-amplified from phRL-TK (Promega, Madison, WI, USA, cat. no. E6241), and the eGFP gene was PCR-amplified from a codon-optimized synthetic gene fragment obtained from Bionics Inc ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... quantitative real-time PCR was performed in Rotor Gene 6000 (Corbett Research) using GoTagR qPCR Master Mix (Promega) according to manufacturer’s instructions with the following primers:
-
bioRxiv - Plant Biology 2024Quote: ... for CDS of the FLC gene cloned into the pGEM®-T Easy vector (Promega, Madison, Wisconsin, US). Oligonucleotides and construct IDs are listed in Table S4.
-
bioRxiv - Microbiology 2022Quote: ... washed three times (10 minutes each) with PBST before incubation for 1 h with α-Mouse IgG HRP Conjugate (Promega) secondary antibody (1:10 000 in PBST) ...
-
bioRxiv - Plant Biology 2021Quote: ... antibodies before probing with horseradish peroxidase (HRP)-conjugated anti-rabbit (for H3) or anti-mouse (for anti-GFP and anti-TUB) as the secondary antibody (1:5000; Promega, Madison ...
-
bioRxiv - Microbiology 2020Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega, #W4021) used at a 1:10,000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... the plates were washed with PBS-T five times and added with a 1:5000 dilution of HRP-conjugated goat anti-mouse IgG antibody (Promega) in blocking buffer at 37 °C for 45 min ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed in 1×PBST and then incubated with the secondary antibody (anti-rabbit or anti-mouse IgG conjugated with horse radish peroxidase at 1:10 000, Promega). The membranes were then revealed using an ECL kit (GE Healthcare ...