Labshake search
Citations for Promega :
151 - 200 of 5090 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 Glo (Promega #G8091) were added and assayed according to the manufacturer’s instructions ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... For the Caspase 3/7 Glo (Promega) assay ...
-
bioRxiv - Biochemistry 2020Quote: ... and Caspase-Glo 3/7 assay (Promega), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Caspase-Glo 3/7 Assay (Promega) was performed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Caspase-Glo 3/7 assays (Promega, G8090) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A caspase - Glo 3/7 kit (Promega) was used to evaluate caspase 3/7 activity based on the kit protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... by Caspase-Glo 3/7 assay (Promega), were assessed using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Caspase-Glo® 3/7 reagent (Promega) was added to each well as per manufacturer’s instruction ...
-
bioRxiv - Microbiology 2024Quote: ... the Caspase-Glo-3/7 kit (Promega) was used as previously described (22) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and caspase-7 activities were measured using a Caspase Glo 3/7 Assay (G8090; Promega, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: The activity of caspase-3/7 was measured by Caspase-Glo-3/7 assay kit according to the manufacturer’s instructions (Promega). Cell death was assessed by an Annexin-V FITC binding assay (Miltenyi ...
-
bioRxiv - Biochemistry 2021Quote: Caspase-3/7 activity was quantified by fluorometric assay using ApoONE Homogeneous Caspase-3/7 Assay Kit (Promega, US). AU565 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Bioengineering 2023Quote: ... 5 µL reactions were made by adding 4 µL LgBiT (Promega, N1120), 0.5 µL 100 µM p86-R4 (Vivitide ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Microbiology 2019Quote: ... 3 μg of RNA was treated with DNase 1 (Promega) for 2 hours at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... The following day activity of caspases 3 and 7 was measured using the Caspase-Glo® 3/7 Assay (Promega), according to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2021Quote: ... Apoptosis was quantified by measuring caspase 3/7 activation of a luminescent signal using Caspase-Glo 3/7 assay (Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase3/7 activity was measured 3 days after the treatment with a commercial available kit (Caspase-Glo 3/7 Assay, Promega).
-
bioRxiv - Cell Biology 2022Quote: ... Caspase 3/7 activity was assayed according to the manufacturer’s protocol for ApoOne® Homogenous Caspase 3/7 Assay (Promega). Fluorescence was measured with Glomax Multi plate reader (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... Treatments were removed 48 or 72 h later and enzymatic activities of caspase-3 and -7 were measured using Caspase-Glo 3/7 Assay (Promega) and read by a microplate reader (SpectraMax M5).
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity was measured using a luminescence Caspase Glo 3/7 assay kit (G8090; Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... induction of apoptosis was determined by measurement of caspase-3/7 activity using the luminometric Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s protocol and a microplate reader (Microplate Reader SH900) ...
-
bioRxiv - Genomics 2022Quote: ... Caspase 3/7 activity was measured 16 and 24 h later using the Caspase-Glo 3/7 Assay System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Caspase 3/7 enzymatic activity in raw cell lysates was measured using a Caspase Glo 3/7 assay kit (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Apoptosis was measured by detecting Caspase 3/7 activity after 24 hours of treatment using the Caspase-Glo 3/7 Assay System (Promega) on a BMG CLARIOstar plate reader ...
-
bioRxiv - Cancer Biology 2024Quote: ... The activity of caspase 3/7 was measured after 48 h using the Caspase-Glo® 3/7 assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... caspase-3/7 activities in cells were measured using a luminometric assay kit Caspase-Glo 3/7 (Promega, Madison, WI). The amount of luminescence was measured on the Victor3™ multilabel reader (PerkinElmer Inc.).
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...