Labshake search
Citations for Promega :
1851 - 1900 of 4270 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... The drug and media were refreshed on day 3 and cell viability was assessed in the cell lines as compared with the vehicle condition (0.1% DMSO) at 7 days post treatment using MTS reagent (Promega, Madison, WI, USA). IC50 values were determined in the cell lines by dose-response curves calculated using the drc (v3.0.1 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA (1 µg) was treated with RQ1 RNase-free DNase (Promega, WI) and then reverse-transcribed using High-Capacity cDNA RT kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed 1 × with PBS and lysed with Cell Lysis Buffer (Promega) at RT for 20min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then lysed in 100 μl of 1× Passive Lysis Buffer (Promega) and luciferase activity in 10 μl aliquots of the cell lysates was measured using the Dual Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 GFP-Sec61β stable cell line was generated by Fugene-HD (Promega) transfection of pAc-GFPC1-Sec61β ...
-
bioRxiv - Neuroscience 2021Quote: ... Further overnight digestion was carried out with 1:20 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ng/well pGL4.74 plasmid (Luc2P/hRluc/TK, control luciferase reporter plasmid, Promega), and 100 ng/well of SMAD2/3 responsive reporter plasmid pGL4.48 (luc2P/SBE ...
-
bioRxiv - Molecular Biology 2021Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:4000 Promega, Fitchburg, USA) was used as secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). The Dual-Luciferase Reporter Assay System and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were washed with PBS and lysed with 1× passive lysis buffer (Promega). Luciferase assay reagent and GLOMAX (both Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers (Supplementary Table 1) and GoTaq® G2 Flexi DNA polymerase (M7801, Promega). Resulting PCR products were purified on columns (Isolate II PCR Kit (BIO-52059 ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were digested overnight at 37 °C with 1 μg of trypsin (Promega). Subsequently ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... approximately 5.2 µg of purified gDNA (spiked with 1% unmethylated lambda DNA, Promega) was sheared into fragment size of 200-300 bp using Covaris S220 ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were digested overnight at 37°C with 1 µg of LysC (Promega) 38 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was reverse transcribed using GoScript Reverse Transcription Mix (A2790, Promega,) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... at a ratio of 11:18:1 using FuGENE HD transfection reagent (Promega). Forty-two hours after transfection ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
Vasohibin1, a new IRES trans-acting factor for sequential induction of angiogenic factors in hypoxiabioRxiv - Cell Biology 2019Quote: ... proteins from HL-1 cells were extracted with Passive Lysis Buffer (Promega France). Quantification of bioluminescence was performed with a luminometer (Centro LB960 ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were digested by adding sequencing grade trypsin (1:20 substrate:enzyme; Promega #5111) and incubating at 37°C for 16 h ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were transfected with 1 µg DNA and 8 µl Fugene HD (Promega) in serum-free media (100 µL total volume) ...
-
bioRxiv - Immunology 2020Quote: ... The medium was supplemented with 1 mM beetle luciferin potassium salt solution (Promega) and bioluminescence assayed at room temperature using Varioskan Flash (Thermo Fischer).
-
bioRxiv - Cancer Biology 2020Quote: ... in a ratio of 100:1 using ViaFect transfection reagent (Promega Cat# E4982). Seven TCF/LEF-binding sites are present upstream of a firefly luciferase gene in the TOPflash vector ...
-
bioRxiv - Bioengineering 2021Quote: ... + 10% FBS containing 1% v/v of cAMP GloSensor substrate stock solution (Promega). The cells were incubated in substrate-containing medium at 37 °C in 5% CO2 for at least 2 h (maximally 8 h) ...
-
bioRxiv - Microbiology 2021Quote: ... cells were resuspended in lysis buffer (1 x FastBreak cell lysis reagent (Promega), 50 μg/mL lysozyme ...
-
bioRxiv - Plant Biology 2020Quote: ... Next 1 µg of total RNA was circularized with T4 RNA ligase (Promega), desalted with Amicon Ultra 0.5ml (10K ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μL of AAV solution was treated with RQ1 DNase (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Inflammasome activity was measured using Caspase-Glo® 1 Inflammasome Assay (G9951; Promega). iPS-Mg were plated at 50,000 cells/well in opaque 96-well plates and treated O/N with PS+ cells ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Cell Biology 2021Quote: ... RPE-1 cells were transfected with pX458 using Fugene HD transfection reagent (Promega) according to the manufacturer’s protocol and 48 hours later cells were selected for 3 weeks with 10 mM Nutlin-3 (Selleck Chemicals) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μL per well of MTS/PMS (20:1, Promega, Madison, WI, USA) solution was added to each well containing 100 μL of culture medium ...
-
bioRxiv - Systems Biology 2022Quote: ... Protein enzymatic cleavage was carried out with trypsin (Promega; 1:20, w/w) at 37 °C for 16 h ...