Labshake search
Citations for Promega :
1701 - 1750 of 4270 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested on beads with 1 μg trypsin (Promega, UK) for 18 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The proteins were on-bead digested with 1 µg trypsin (Promega) for 4 hours at 37 °C under agitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were lysed with 100 μL of 1 x PLB (Promega). Luciferase activities were measured by Dual-Luciferase Reporter Assay System (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-mouse IgG HRP conjugate (Promega, catalog no. W4021, 1:40,000), goat anti-rabbit IgG HRP conjugate (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega W4021, 1:2,500) and anti-rat IgG (H+L ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-mouse IgG HRP conjugate (Promega, catalog no. W4021, 1:40,000). Unless otherwise stated ...
-
bioRxiv - Biochemistry 2024Quote: ... with on-column RQ1 RNase-Free DNase 1 treatment (Promega, USA). cDNA was synthesized using the SuperScriptTM IV First-Strand Synthesis System (ThermoFisher ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-goat IgG conjugated to HRP (1:10,000, Promega, PA1 28664), anti-H3 (1:2500 ...
-
bioRxiv - Physiology 2024Quote: ... Overnight digestion with Lys-C/Trypsin combo (1:50 enzyme:protein; Promega). After stopping the digestion with 1% trifluoroacetic acid ...
-
bioRxiv - Biophysics 2019Quote: ... we mixed 3 ng/μL of lambda DNA (D1501, Promega) and 5 nM of condensin in an Eppendorf tube for a 10 min incubation to induce condensin-DNA interaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured 3 days later using CellTiterGlo (Promega).
-
bioRxiv - Immunology 2020Quote: ... the protein suspension was digested with 3 μg trypsin (Promega) in 40 μl 25 mM NH4HCO3 overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... (3) we used ProNex Size-Selection DNA purification System (Promega) for purification of PCR product ...
-
bioRxiv - Cancer Biology 2019Quote: ... cleaved caspase 3 was visualized with antibody (Promega Cat # G7481)) labeled with Qdot 655 Streptavidin conjugate (Thermo Cat# Q10121MP) ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of nuclease free water (Promega, Cat No. P119E), and 5 µl of cDNA using the following program ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were suspended in 10 mL MACS buffer (2% FBS, 2 mM EDTA (Promega, V4231) diluted in phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Molecular Biology 2020Quote: ... Prior to the addition of 1 μl of MMLV-RT enzyme (Promega), the reaction was incubated at 65°C in order to denature double stranded RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Any potential contaminating DNA was removed by DNase digestion (RQ-1, Promega); RNA was subsequently purified on a column (RNA Clean & Concentrator-25 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The primary antibodies used are mouse β-Gal (1:250; Promega #Z3781), mouse anti-Wingless (1:100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histones were then digested with 1 μg of sequencing grade trypsin (Promega) diluted in 50mM ammonium bicarbonate (1:20 ...
-
bioRxiv - Molecular Biology 2022Quote: ... in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega) at 18°C overnight and then at room temperature for 1 hour and inactivated at 65°C for 20 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL of 100× diluted furimazine (Nano-Glo luciferase assay reagent, Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: ... 200 μL of rabbit polyclonal antibody against PLRV-CP (1:5000; Promega) was added to each well and incubated for 3 h at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The denatured RNA was mixed with 1 μl of rRNasin® (Promega), 5 μl VRC ...
-
bioRxiv - Pathology 2020Quote: ... respectively) containing β-galactosidase (1 mg/ml; Cat # V394A; Promega, Madison, WI). Samples were post fixed in formalin overnight and then stored in ethanol (70%).
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μL (50 ng) of pGEM®-T-Easy vector (Promega, USA), 1 μL of 10X ligase buffer ...
-
bioRxiv - Genomics 2021Quote: ... polyclonal anti-mouse IgG-HRP raised in goat (W402B, 1:3,000; Promega) and polyclonal anti-rabbit IgG-HRP raised in goat (R1364HRP ...
-
bioRxiv - Biochemistry 2020Quote: ... The genomic DNA contamination was removed with 1 µl of DNaseI (Promega) treatment for 60 minutes at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Dual-Glo Stop & Glo Reagent diluted (1:100) in culture medium (Promega) was added to each well and the luminescence of the renilla luciferase was measured after 20 min incubation at RT ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM L-Glutamin and 250 μM Luziferin D (Promega, Madison, USA). Cells were incubated 12-16 hours in a humidified incubator at 37°C and 5% CO2 to adhere to the bottom of the plate ...
-
bioRxiv - Cell Biology 2021Quote: ... all buffers were supplemented with RNAse inhibitor (RNasin, #N2111, Promega, 1:320.000). Cells were mounted in Prolong Diamond (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were lysed with 1× passive lysis buffer (Promega, Madison, WI, USA). TOPFlash/Renilla luciferase assays were performed using the dual-luciferase reporter assay kit (Promega ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then lysed with 25μL of 1×passive lysis buffer (Promega) for 30 min at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... GoTaq® Probe 1-Step RT-qPCR System was purchased from Promega. SARS-CoV-2 (2019-nCoV ...
-
bioRxiv - Plant Biology 2021Quote: ... digested by 1 µg sequence-grade modified trypsin (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... The standard curve was generated using GoTaq 1-Step RT-qPCR (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... the proteins were digested with 1 μg trypsin/Lys-C mix (Promega) at 37 °C overnight ...