Labshake search
Citations for Promega :
1701 - 1750 of 3883 citations for 6 METHOXY 2 METHYL 1 PHENYLSULFONYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... 1 unit of RNase ONE™ (Promega) or 0.01 unit of RNase V1 (Thermo Fischer Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of GreenLys solution (FluoroTect, Promega) was supplemented to a PUREfrex2.0 mix (total volume 10 µL ...
-
bioRxiv - Microbiology 2021Quote: ... 1% SDS) containing protease inhibitor cocktail (Promega), Sodium fluoride (10 mM ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 μL of 0.2 M DTT (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... GoTaq 1-Step RT-qPCR kit (Promega) was used at a final volume of 20 μl with ...
-
bioRxiv - Biophysics 2020Quote: ... and 1 U/µL RNasin Plus (Promega) and flash frozen in liquid nitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... or 10:1 (w/w) elastase (Promega), using the manufacturer’s recommended temperatures for 18 hours with 600 rpm shaking ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg sequencing grade trypsin (Promega) was added for further protein digestion (37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg of sequencing grade trypsin (Promega), diluted in 50 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... and 1 U/µL RNAsin Plus (Promega) and flash frozen in liquid nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 U/ml RNAsin-Plus (Promega) in PBS for one minute ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:200 RNaseIN plus RNAse inhibitor(Promega), protease inhibitor diluted into RNAse free PBS(Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of 10 mM dNTPs (Promega), 5 μl MgCl2 (GoTaq) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 U GoTaq® DNA Polymerase (Promega) and 6 µL of the template DNA ...
-
bioRxiv - Zoology 2021Quote: ... 1 U Go-Taq Flexi polymerase (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... and 1:1000 RNaisin Plus (Promega, #N2615). Samples were vortexed and kept on ice ~30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then 1 μg sequencing grade trypsin (Promega) was added to each sample and incubated at 37 °C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... Corning)/RNase-free DNase (1:500, M6101,Promega) solution for 20 min at 37°C (Frank et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 ul of dNTP (Promega U1511). The remaining volume was brought up to 11.8 ul using nuclease-free water (ThermoFisher AM9937) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 µg of sequencing grade trypsin (Promega) diluted in 50 mM ammonium bicarbonate was added to the S-trap filter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The BenchTop 1-kb DNA Ladder (Promega) was used to estimate the size of DNA.
-
bioRxiv - Developmental Biology 2019Quote: ... anti b-galactosidase (1:100, Promega Z3781), antiGFP (1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... and anti-mouse (1:3000; Promega #W4021) were used for detection with chemiluminescence (HyGLO Chemiluminescent HRP Antibody Detection Reagent ...
-
bioRxiv - Pathology 2020Quote: ... using GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 µM of random hexamers (Promega) in accordance with manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1:1000 RNaisin Plus (Promega #N2615) before use] ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-gal (Promega 1:500), chicken-anti-GFP (Invitrogen 1:1000) ...
-
bioRxiv - Biophysics 2019Quote: ... NanoLuc substrates (Promega, after 1:20 dilution) were added at 10 μl/well followed by incubation by 10 μl of 4×compound solutions for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1 GoTaq™Flexi PCR buffer (Promega) and 20 pmol of each of the following four primers ...
-
bioRxiv - Genetics 2019Quote: ... and 1 mM of each dNTP (Promega) (Jeffreys et al ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were trypsine/LysC (1 μg, Promega) digested in a total volume of 200 μL with vortexing at 37°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-β-gal (Promega 1:500), chicken-anti-GFP (Invitrogen 1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of 10 mM dNTPs (Promega), and 18.5 μl UV-sterilized ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL MgCl2 (25 mM) (Promega, # A351H) and the reaction was made up to 25 μL with H2O ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1 mL of lysis buffer (E4030, Promega) was applied for 10 minutes on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Mouse anti-βGal (1:1000, Promega). The following antibodies were obtained from the Developmental Studies Hybridoma Bank ...
-
bioRxiv - Systems Biology 2021Quote: ... and 1 mg sequencing grade trypsin (Promega) per 100 mg total protein was added to each lysate and incubated for 16 hours at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... 1 unit of RQ DNase I (Promega) was added and incubated at room temperature for 10 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Beta Galactosidase (1:1000, Promega), mouse anti-Beta Galactosidase (1:10 ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 U/μL RNase inhibitor (Promega) for 1 h at 30 °C.
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-ß Galactosidase 1:200 (Promega), anti-ß Galactosidase 1:500 (Cappel) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 U of GoTaq DNA Polymerase (Promega) and 1X of Green GoTaq Reaction Buffer (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 U of GoTaq DNA Polymerase (Promega) and 1X of Green GoTaq Reaction Buffer (Promega ...
-
bioRxiv - Immunology 2021Quote: ... and 1 µg sequencing grade trypsin (Promega) was added for further protein digestion (37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 uM of random hexamers (Promega). The reaction was performed at 20 uL final volume and was incubated at 37 °C for 60 min followed by enzyme inactivation at 70 °C for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 U/μl RNasin (Promega, Cat# N2511), 0.1% IGEPAL CA630 (Sigma-Aldrich ...