Labshake search
Citations for Promega :
1551 - 1600 of 3883 citations for 6 METHOXY 2 METHYL 1 PHENYLSULFONYL 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 1 % NanoGlo Live Cell substrate (Promega) was then added ...
-
bioRxiv - Neuroscience 2021Quote: ... and p75NTR (Promega, G3231, 1:500) were applied overnight at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... and p75NTR (Promega, G3231, 1:50) immersed in blocking solution were added to the teased muscle fibres for ∼3 d at 4°C with mild agitation ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl 10 mM dNTPs (Promega), 1 µl 0.1 M dithiothreitol (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 ng of Trypsin Gold (Promega) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL NanoGlo substrate (Promega, N1110) was added at a final dilution of 2100-fold after 30 min incubation at room temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Trypsin (1:100, Promega, Cat # V5280) was then added for overnight incubation at 37°C with intensive agitation (1000 rpm) ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-Lacz (1:200)(Promega), rabbit anti-CD4 (1:250)(Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... α-HaloTag 1:1000 (Promega, G9211), or α-Flag 1:5000 (Sigma-Aldrich ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... and nanoluc substrate (Promega, 1:200) diluted in 1X passive lysis buffer (Promega) ...
-
Arc mediates intercellular synaptic plasticity via IRSp53-dependent extracellular vesicle biogenesisbioRxiv - Neuroscience 2024Quote: ... and nanoluc substrate (Promega, 1:200) diluted in 1X passive lysis buffer (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg/µl BSA (#R396A, Promega), 10 mM vanadyl-ribonucleoside (VRC ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 μg of trypsin (Promega, V5280) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... bIII-tubulin (1:1000, Promega, G7121), LMX1(1:500 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 µl 1% digitonin (Promega,#G9441), 0.1 µl 10% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... anti-LgBiT (1:500, N7100, Promega), anti-MCPyV LT (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml FuGENE HD (Promega, E2312) transfection mix containing 30 μl FuGENE HD and 8 μl of each plasmid was prepared per plate ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 kb DNA ladder (Promega) was used as a size marker ...
-
bioRxiv - Immunology 2023Quote: ... 1 mmol/L dithiothreitol (V315A, Promega), 5 mmol/L β-glycerophosphate (G6376 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 g of firefly luciferin (Promega) was dissolved in 66.6 mL of sterile PBS to create a 15 mg/mL solution ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg of modified trypsin (Promega) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Halo (1:1000, mouse, Promega), anti-Myc (1:100 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A). Thermal cycling was as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A), was added to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1:250 RNasin (Promega, #2515). Centrifugally clarified cell extracts were incubated with affinity medium (20 μl of slurry for αORF1p and αORF2p for 30 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Beta III Tubulin (1:2000, Promega), and PSD-95 (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... 1 Inflammasome Assay was from Promega. HTRF kits to detect IL-1b ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:100 RNasin Plus (Promega N2615), and 1:200 Alexa Fluor 488 anti-GFP antibody (BioLegend 338007 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... against 1 kb DNA ladder (Promega) and photographed under UV illumination (see Supplementary Figures S3 and S4 for examples) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 U μl-1 RNAsin (Promega), 1Å∼ Superscript II First-Strand Buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 1% unmethylated Lambda DNA (Promega #D1521) was spiked into genomic DNA to monitor bisulfite conversion efficiency ...
-
bioRxiv - Immunology 2024Quote: ... 1 µg sequence grade trypsin (Promega) was added overnight at 25°C ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Microbiology 2024Quote: ... rabbit anti-Halo (1:300, Promega), rabbit anti-H3K9me3 (1:300 Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of random hexamers (Promega), and brought to 20 μL total volume with nuclease-free water ...
-
bioRxiv - Physiology 2024Quote: ... HRP Conjugate (1:2,500, Promega, W4011) secondary antibody for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...