Labshake search
Citations for Promega :
1651 - 1700 of 4408 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... One μg of total RNA was DNase treated following the RQ1 RNase-Free DNase protocol (Promega) and then reverse transcribed with a mixture of random primers and oligo(dT ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell proliferation was assessed using the CellTiter96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Promega).
-
bioRxiv - Immunology 2019Quote: ... the plates were assayed using the CytoTox-ONE Homogenous Membrane Integrity Assay (#G7890, Promega, Madison, WI) as per the kit protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Necrosis measurement was performed using CytoTox-One Homogeneous Membrane Integrity Assay according to manufacturer’s instructions (Promega). For Caco-2 cells (passage 30-45) ...
-
bioRxiv - Biochemistry 2020Quote: ... Two control reactions were performed: one containing 8 units of HeLa nuclear extract provided by Promega as a positive control and the other containing no nuclear protein as a negative control ...
-
bioRxiv - Bioengineering 2020Quote: ... Cell proliferation was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega Corporation) as per manufacturer’s instructions and quantified by absorbance at 490nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μL CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS; Promega, Madison, WI, USA) was added and incubated 1−4 hours at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with CellTiter 96® AQueous One Cell Proliferation Assay solution (Promega, Wisconsin, U.S.A.) for 2 h at 37°C ...
-
bioRxiv - Physiology 2022Quote: One tube was used for NAD/NADH quantification using the NAD/NADH Glo™ Assay (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... MTS assay was performed by adding 20 μl of reagent (Promega CellTiter 96 Aqueous One Solution) to each well and incubated at 37°C for 2 hours ...
-
bioRxiv - Microbiology 2022Quote: ... Luciferase activity was measured using a ONE-Glo™ EX Luciferase Assay System (Promega, Cat# E8130).
-
bioRxiv - Cancer Biology 2022Quote: ... Growth inhibition measured at 490 nm by CellTiter 96 AQueous One Solution Cell Proliferation assay (Promega). Viability (100 % ...
-
bioRxiv - Microbiology 2021Quote: ... 20 µL of the MTS salt containing CellTiter 96 Aqueous One Solution reagent (Promega, Madison, WI) was added and incubated for further 1-2 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... the cell viability was assessed using Celltiter 96®AQueous One Solution (Promega Corp, WI, USA) or CellTiter-Glo® One Solution Assay system (Promega ...
-
Inclusion Complexation of S-Nitrosoglutathione for Sustained NO Release and Reduced Device InfectionbioRxiv - Biochemistry 2022Quote: ... The CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) kit was obtained from Promega Corporation.
-
bioRxiv - Molecular Biology 2022Quote: ... The genomic DNA concentration was quantified using the Quantifluor® ONE dsDNA Dye System (E4971, Promega). Genomic DNA (5–20 ng ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 μL of CellTiter 96 Aqueous One Solution cell proliferation assay (MTS) (Promega, Cat. No. G3581) was added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... For MTS assays the CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) from Promega was used (Promega #G3580) ...
-
bioRxiv - Cell Biology 2021Quote: ... the luminescence of each well was measured using a ONE-Glo™ Luciferase Assay System (Promega) in the Infinite M200 Pro NanoQuant (TECAN) ...
-
bioRxiv - Epidemiology 2021Quote: ... Cell Titer 96 Aqueous One Solution Cell Proliferation assay (MTS) was purchased from Promega (Madison, USA). Goat anti-mouse IgG ...
-
bioRxiv - Biochemistry 2021Quote: ... Reacted sequences were isolated by addition of one sample volume of Streptavidin MagneSphere paramagnetic beads (Promega) per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from one μg RNA with GoScript™ Reverse Transcription System (Promega, Benelux BV) and thereafter diluted to 1:30 (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... and the other one was lysed for luciferase assay (40) using a commercial luciferase system (Promega). The luciferase activity in the test tubes was measured using a Turner BioSystems TD-20/20 Luminometer and reported as relative luciferase units (RLU ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 microliters of CellTiter 96® AQueous One Solution Cell Proliferation Assay solution (MTS, Promega G3580) prepared in DMEM + 5% FBS was added to each well ...
-
bioRxiv - Cancer Biology 2023Quote: Cell growth was monitored using Cell Titer 96 AQueous One proliferation assay (MTS) (Promega, Madison, WI) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Cell viability was assessed using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay Kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Firefly luciferase activity was quantified using the ONE-Glo™ EX Luciferase Assay System (Promega, E8130) and read with the Synergy NEO2 multimode reader (BioTek) ...
-
bioRxiv - Molecular Biology 2023Quote: ... firefly luciferase activity was determined by using the One-Glo reagent according to manufacturer’s recommendations (Promega). The results were then normalized to SCR.
-
bioRxiv - Genetics 2024Quote: ... One µg of total RNA was reverse-transcribed by using the ImProm-ⅡTM Reverse Transcriptase (Promega). Three types of primers were used for the reverse transcription reaction ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... a master mix was prepared by diluting the Extracellular NanoLuc Inhibitor at a 1:1000 ratio and the NanoBRET Nano-Glo Substrate at a 1:333 ratio in PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of pPAX packaging vector and 1 μg of VSV-G envelope vector using FuGENE® HD Transfection Reagent (Promega, cat.no. E2311), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...