Labshake search
Citations for Promega :
1601 - 1650 of 4877 citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was determined using the CellTiterGlo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and purified with the Wizard SV Gel kit (Promega). The purified DNA was incubated with DpnI (New England BioLabs® ...
-
bioRxiv - Genetics 2021Quote: ... using the Maxwell 16 Tissue DNA Purification kit (Promega). The ddRAD-seq library was constructed using all the genomic DNAs according to the method described in Peterson et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Microbiology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cAMP-Glo™ Assay kit (Promega, Cat. no. V1501) was used to measure cellular cAMP levels via GloMax® Discover Microplate Reader (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... with Maxwell® RSC simplyRNA Tissue Kit (AS134, Promega), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines were either fingerprinted (PowerPlex 1.2 Kit, Promega) or independently authenticated annually (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... or Maxwell 16 LEV simplyRNA cell kit (Promega; #AS1270), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... Assays were performed using the dual luciferase kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Dual-Luciferase Reporter Assay Kit (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Dual-GLO®Luciferase Assay System Kit (Promega). Firefly luciferase activities were normalized to Renilla luminescence in each well.
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using PCR cleanup kit (Promega). Sanger sequencing was performed at Psomagen ...
-
bioRxiv - Bioengineering 2023Quote: Wizard Genomic DNA Purification Kit (Promega cat. no. A1125)
-
bioRxiv - Cancer Biology 2023Quote: ... using a Dual-Glo luciferase kit (Promega, Cat# E2920) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were authenticated using the GenePrint 24 kit (Promega) at the DNA Sequencing Core Facility ...
-
bioRxiv - Immunology 2023Quote: ... the MultiTox-Glo Multiplex Cytotoxicity Assay kit (Promega, G9272) was used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted (ProMega Wizard Genomic DNA kit) and barcoded with a Nanopore technologies rapid barcoding kit ...
-
bioRxiv - Microbiology 2023Quote: ... coli cells using Wizard SV Plus Miniprep Kit (Promega) or the QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2022Quote: ... or Maxwell® RSC simplyRNA Tissue Kit (Promega, AS1340) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: A Cytox 96 Non-Radioactive Cytotoxicity Assay Kit (Promega) was used to measure the activity of lactate dehydrogenase (LDH ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using the GoTaq® qPCR Master Mix kit (Promega) in 384-well plates ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: In vitro-translated ERRα full length (TNT kit; Promega) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... GTPase-GLO assay kit were purchased from Promega (V7681) (Madison ...
-
bioRxiv - Immunology 2023Quote: ... ATP was measured with Mitochondrial ToxGlo Assay kit (Promega) and followed the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: ... or the Maxwell® RSC simplyRNA Tissue kit (Promega) were utilized ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the Dual Luciferase Reporter Assay kit from Promega. Firefly luciferase activity was normalized against Renilla luciferase activity.