Labshake search
Citations for Promega :
1551 - 1600 of 5340 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The amplicon was purified Wizard SV Gel and PCR Clean-up System (Promega) and was used to produce preselected libraries ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR was performed using either GoTaq G2 Green Master Mix (Cat#M782B, Promega) or Kapa Hifi Hotstart Ready Mix ...
-
bioRxiv - Plant Biology 2023Quote: ... purified using Wizard® SV Gel and PCR Clean-Up System (Promega, USA), according to the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were cloned in the pGEM T Easy vector system (Promega) according to the manufacturer’s instructions and sequenced (Eurofins Genomics and SourceBioscience) ...
-
bioRxiv - Pathology 2023Quote: ... we performed two overlapping PCR on the RCA products with GoTaq Flexi (Promega) according to the manufacturer’s protocol to amplify the complete genome of MSV using primers targeting MSV-G (PCR#1 ...
-
bioRxiv - Genomics 2023Quote: ... Extracted DNA was used to template PCR reactions with GoTaq polymerase (Promega #M3001) to amplify ITS (primers emITS-1:TGGTAGAGAATGATGGCTGTTG and emITS-4:GCCTCTATGCCTAATTGCCTTT ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR product was first cloned in the pGEM-T Easy vector (Promega) and sequenced ...
-
bioRxiv - Cell Biology 2024Quote: ... The genome-edited monoclonal cell populations were identified by PCR (GoTaq Polymerase, Promega) and then verified by western blot analysis and imaging.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was run for 30 cycles using GoTaq G2 Green master mix (Promega) and specific primers ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were sub-cloned into the pGEM-T Easy vector (Promega, A1360) and sequenced ...
-
bioRxiv - Plant Biology 2024Quote: ... The secondary PCR product was cloned in pGEMT-Easy vector (Promega Madison, USA), and Sequencing was performed using the nos promoter’s AP2 and 5’ junction (Eurofins Genomics India Pvt ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were verified by sequencing cloned into the pGL3-Control vector (Promega) by Gibson Assembly ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed with GoTaq G2 Flexi DNA Polymerase (Promega, Cat. #M7801) or Herculase II Fusion DNA Polymerase (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed with a Gotaq G2 Hot Start Polymerase system (#M7405, Promega). Pyrosequencing was conducted on a Pyromark Q96 Sequencer using matching reagents (#97204 ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... and Cd68 were quantified by using GoTaq PCR master mix (Promega, Madison, WI) in OneStep Plus qPCR (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products (deletion-bearing, second-step amplicon) and the pGL4.23 vector (Promega) were double digested with NheI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... the PCR products of the Strep-Flag-tag and NLuc (Promega, cat # N1091) were inserted into the pHLmMBP-8 vector (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... Untagged CDK2 expression plasmid was cloned by PCR with CDK2-NLuc plasmid (Promega) as the template ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified using Wizard® SV Gel and PCR Clean-Up System (Promega). Next ...
-
bioRxiv - Neuroscience 2023Quote: The PCR fragment were ligated into a pGEM-T Easy Vector System (Promega), transformed into chemically competent cells and sequenced ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 min at 60°C) an alkylation (IAA 0.5M, 30 min RT) microtubule-associated protein enriched fractions were digested using trypsin (Gold, Promega, 1 μg / sample, overnight at 30°C). Peptide clean-up was done using OMIX C18 (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... washed three times (10 minutes each) with PBST before incubation for 1 h with α-Mouse IgG HRP Conjugate (Promega) secondary antibody (1:10 000 in PBST) ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were collected at the specified time points with LDH release quantified with a CytoTox96 Non-Radioactive Cytotoxicity Assay (Promega). Cytotoxicity was measured per well as a percentage of max LDH release ...
-
bioRxiv - Neuroscience 2020Quote: In vitro translation rates represent the increase in luminescence as a function of time using a standard rabbit reticulocyte lysate system (Promega) with luciferase mRNA (Promega) ...
-
bioRxiv - Genomics 2019Quote: 48 hours after transfection the HEK293T cells were washed 3 times with PBS and lysed in 100μl of Passive Lysis Buffer (Promega, E1910). Firefly luciferase and Renilla luciferase activities were measured in 10μl of HEK293T cell lysate using the Dual-Luciferase Reporter assay system (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... the cells were washed three times with PBS followed by addition of 100ul of 1X Passive lysis buffer (PLB, Promega). The cells were then scraped and transferred to a 96 well plate ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Genomics 2021Quote: ... Membranes were washed three times in TBS-T before incubating with secondary antibodies (HRP-anti Mouse-IgG (H+L) (Promega)) for 45 min in TBS-T and 2% milk ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Genomics 2022Quote: ... Then the gel beads were washed with DPBS three times and 200 μL of proteinase K solution (1 mg/mL proteinase K [Promega, Madison ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Media from the basal layer of the tissue were collected at the same time points for LDH cytotoxicity measurements (LDH-Glo Cytotoxicity Assay, Promega). TCID50 assay was performed as previously described [19] ...
-
bioRxiv - Cell Biology 2022Quote: ... Trapped proteins were washed four times with the methanol TEAB buffer and then digested overnight at 37°C using 1ug Trypsin (Promega). Digested peptides were eluted and dried in a vacuum centrifuge before LC-MS analysis.
-
bioRxiv - Microbiology 2022Quote: ... and the Gaussia princeps luciferase enzymatic activity was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies, reading time 10 s after injection of 50 µl Renilla luciferase reagent (Promega). For the minigenome assays ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapped proteins were washed four times with the methanol TEAB buffer and then digested using 1 µg Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... the plates were washed with PBS-T five times and added with a 1:5000 dilution of HRP-conjugated goat anti-mouse IgG antibody (Promega) in blocking buffer at 37 °C for 45 min ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed with PBS-T 5 times and a 1:5000 dilution of HRP-conjugated goat anti-rabbit IgG antibody (Promega) was added for 45 min at 37 □ ...
-
bioRxiv - Microbiology 2022Quote: ... Nluc activity in the cell culture supernatants at the same times post-infection was quantified using a microplate reader and a Nano-Glo Luciferase Assay system (Promega) following the manufacturers’ recommendations ...
-
bioRxiv - Pathology 2021Quote: ... RNA was quantified using a Qubit and 300 ng of total RNA from each time point was used to develop cDNA using the GoScriptTM Reverse Transcription System (Promega). With the use of gene specific primers SnTox5_qPCR_F and SnTox5_qPCR_R ...
-
bioRxiv - Biochemistry 2019Quote: ... for the indicated times at 37 °C and activity was measured using the Dual-Glo Luciferase Assay System (Promega, E2940) in a Tecan Infinite M200 Pro multi-well plate reader ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase assays require washing the harvested cells 3 times in PBS prior to lysis in passive lysis buffer (Promega, E1941). NLuc activity was assayed using the Nano Luciferase Assay Kit (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... The slurry was then diluted four times with 20mM Tris-HCl with 2mM CaCl2 before digestion overnight with 100 ng sequencing grade trypsin (Promega). The samples were then centrifuged for peptide extraction from the supernatant which were then subject to liquid chromatography LC-MS (PROXEON coupled to a QExactive mass spectrometer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... 10 μL of the medium at several time points was collected for gLuc expression assay using Renilla Luciferase Assay System (Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Microbiology 2023Quote: ... princeps luciferase enzymatic activity due to luciferase reconstitution was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies) using a reading time of 10 s after injection of 50 µl Renilla luciferase reagent (Promega). Mean relative light units (RLUs ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Supernatants were assayed for LDH release immediately after stimulation time courses per the manufacturer’s protocol from the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega). Measurements of absorbance readings were performed on a microplate reader at wavelengths of 490 nm and 680 nm ...
-
bioRxiv - Microbiology 2023Quote: ... The columns were then washed three times with a wash solution (90% methanol; 100mM (final concentration) TEAB) before digestion with 100ug trypsin (Promega) (1/10 ...