Labshake search
Citations for Promega :
1501 - 1550 of 2229 citations for 6 BROMO 3 4 DIHYDROQUINOLINE 2 1H THIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: 293T cells were transfected with pSpCas9(BB)–2A–Puro:sgRNA #4 (0.5 μg) using the FuGENE HD Transfection Reagent (Promega). Two days after transfection ...
-
bioRxiv - Genomics 2020Quote: ... We removed RNA species in the nucleic acid via the addition of 4 μg of RNase A (Promega), and incubation at 37°C for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 hours after plating cells were transfected with 1μg of histone H3.3-HaloTag®Fusion Vector DNA (Promega) + 0.1 μg of NSD2 PWWP1-NanoLuc® Fusion Vector DNA (C-terminal ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by 4-fold dilution and an overnight digestion with 500 ng trypsin (Promega, Charbonnieres les Bains, France). Peptide mixtures were then desalted on C18 spin-column and dried on Speed-Vacuum.
-
bioRxiv - Microbiology 2019Quote: ... The cells were fixed with 4% paraformaldehyde for 5 min and permeabilised with 0.2 % Triton X-100 (Promega) in PBS for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Microbiology 2021Quote: ... Cells (100 μL) were then incubated with 4 μM cheopin or Fast Break lysis solution (Promega, Madison, WI) and absorbance at 405 nm was measured for 1h using a BioTek Synergy H1M plate reader set to 28°C.
-
bioRxiv - Biophysics 2021Quote: ... Proteins were then trypsin digested as follows: initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Genomics 2020Quote: ... each of the wells containing 0.5 μl of lysis solution (0.2% Triton X-100 [Roche], 0.8 units of RNasin Plus [Promega], 4 mM dNTPs [Promega] and 1 μM of barcoded oligo-dT primers [E3V6NEXT ...
-
bioRxiv - Microbiology 2020Quote: ... In-gel digestion was performed by adding 25 μL of 4 μg/mL sequencing grade modified trypsin (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Dry gel pieces were digested with 200 μL of mass spectrometry-grade trypsin solution (4 ng/μL, Promega) in AMBIC and incubated at 37°C for 18 h ...
-
bioRxiv - Genetics 2022Quote: ... Transfection efficiency was determined in parallel by preparing transfection mixes containing 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... The fluorescently labeled PCR products were digested by using the 4-bp cutter TaqI (Promega, Southampton, United Kingdom) as described by the manufacturers ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcripts of interest were amplified using designed primers (Supplementary Table 4) and cloned into pGEMT-Easy vector (Promega). Digoxigenin-labelled antisense and sense RNA probes were transcribed from T7 or SP6 promoter of pGEMT-Easy vector (Promega ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated from 4-day-old wild-type seedlings using a Maxwell RSC Plant Kit (Promega). cDNA was synthesized from total RNA (100 ng ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligation of the digested pGEM-T easy vector and 5’ fragments was carried out overnight at 4 °C using 0.5 µl (1.5 U) of T4 DNA Ligase (Promega). pGEM-T easy vector containing the 5’ fragment (5’-pGEM-T ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Genetics 2019Quote: ... total RNA was treated with 2 U of RQ1 RNase-Free DNase (Promega, USA) at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: - A combination of KAPA HotStart ReadyMix and Pfu DNA Polymerase (2 U/μL, Promega) was used in some tests to try to increase enzyme processivity ...
-
bioRxiv - Microbiology 2021Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega). CSV files were exported onto a USB flash drive for analysis.
-
bioRxiv - Systems Biology 2020Quote: ... The transfections were performed with 1 μg DNA: 2 μl Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Physiology 2021Quote: ... and simultaneously transfected with 2 μg of DNA using Fugene HD (catalog #E2312, Promega), accordingly to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega).
-
bioRxiv - Microbiology 2022Quote: ... 2 cm strips of intestinal tissues were embedded in low melting point agarose (Promega) to enrich for well-oriented crypt-villus units ...
-
bioRxiv - Plant Biology 2021Quote: ... http://cshprotocols.cshlp.org/content/2009/2/pdb.prot5110.abstract) with trypsin (porcine, side chain protected; Promega). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... and the pre-cleared lysate was supplemented with 2 µl of RNasin Plus (Promega), added onto the freshly prepared ...
-
bioRxiv - Biophysics 2020Quote: ... containing 10% (vol/vol) FBS and 2% (vol/vol) GloSensor cAMP stock solution (Promega). The cells were then incubated for 2 hours at room temperature in the dark ...
-
bioRxiv - Microbiology 2020Quote: ... Two days after transfection with 2 to 2.5 μg DNA using Fugene HD (Promega), confocal images were acquired using an FV1000 confocal laser scanning microscope (Olympus ...
-
bioRxiv - Microbiology 2021Quote: ... We synthesized cDNA from 2 μL of RNA using M-MLV reverse transcriptase (Promega) and random hexamers ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was initiated by addition of a mixture of 2 μM coelenterazine-h (Promega) and 40 μM 3-isobutyl-1-methylxanthine (IBMX ...