Labshake search
Citations for Promega :
1451 - 1500 of 1751 citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies were detected with an anti-mouse secondary antibody conjugated to HRP (Promega) at 1:5000 dilution in 5% fat-free milk ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Dad13 constructs were detected with using mouse-anti-β-galactosidase (1:1000, Promega) and rabbit-anti-β-galactosidase (1:1000 ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: Anti-mouse and anti-rabbit Abs conjugated with horseradish peroxidase (HRP) were from Promega Biotec (Madison ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (0.5 µg) was reverse transcribed with mouse myeloblastosis virus reverse transcriptase (Promega) under standard conditions using hexanucleotide random primers according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:3,000 Promega, Fitchburg, United States) was used as secondary antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: The mouse Il12b promoter (−355 to +55) was cloned into the pGL4.10 vector (Promega). Motif mutations were introduced using the GENEART site-directed mutagenesis system (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from mouse liver using a Maxwell 16 LEV simplyRNA kit (Promega). For the American vs standard diet comparison strand-specific mRNA libraries were generated using the TruSeq Stranded mRNA protocol (Illumina ...
-
bioRxiv - Biochemistry 2022Quote: ... but the secondary antibodies were goat anti-mouse HRP conjugated antibody (Promega Cat #W4021) and goat anti-rabbit HRP conjugated antibody (Promega Cat # W4011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... on embryos/larvae using mouse anti-β-gal (Promega catalog number Z3781, 1:1000) and rabbit anti-mCherry (BioVision ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit and mouse anti-β-Gal (MP Biomedics #559761 and Promega #Z378A, 1:1000), rabbit and mouse anti-pH3 (Merck Millipore #06-570 and Cell signal technology #9796 ...
-
bioRxiv - Microbiology 2020Quote: ... Transfection of HEK293T cells was performed at 80% confluence using 25ng of each plasmid construction mixed with 150nL of Fugene 6 (E2691, Promega, France) reagent per well ...
-
bioRxiv - Cell Biology 2020Quote: ... Heterologous expression of proteins was achieved by transfecting cells with 1 □g of plasmid DNA/35 mm using FuGENE HD (Promega; E2311), as previously described (Webb et al. ...
-
bioRxiv - Cell Biology 2020Quote: BBSome subunits and fragments thereof were translated in vitro from pCS2-Myc plasmids using the TNT SP6 Quick Coupled Transcription/Translation system (Promega L2080). 16 µL TNT SP6 Quick Master Mix ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... colonies that grow under ampicillin selection were tested by sequencing of the purified plasmid using Wizard Plus SV Minipreps DNA Purification (Promega; A1330). Primer used for the validation sequencing is TTAGGCAGGGATATTCACCA ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting 2.6-kb fragment was separated from the 1.4-kb fragment and uncut plasmid by agarose gel purification (Promega Gel Wizzard Kit). A set of oligonucleotides that form a biotinylated and primed fork was ligated to one end of the fragment and the final product purified on a Sepharose-4B column as previously described [42] ...
-
bioRxiv - Synthetic Biology 2019Quote: Liquid cultures of the transformed cells were used for plasmid extraction and purification using the Wizard® Plus SV Minipreps DNA Purification System kit (Promega). The plasmids quality and concentration were quantified using the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were transfected with 700 ng of plasmid construct (PIB/V5_Gr9) and 3 μl of FuGENE® HD transfection reagent (Promega, USA) in 100 μl of medium per well ...
-
bioRxiv - Genomics 2019Quote: ... we used a standard curve approach with serial ten-fold dilutions of plasmids engineered to contain single copy PCR templates (pGEM®-T Easy Vector, Promega).
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Microbiology 2021Quote: ... the lacZα expression cassette encoding the alpha-fragment of the β-galactosidase under control of the lac promotor and operator was amplified from the circularized plasmid pGEM-T (Promega) using the forward primer 596 that includes a 5’ XhoI restriction site and the reverse primer 597 which includes a 3’ KpnI restriction site ...
-
bioRxiv - Cancer Biology 2020Quote: ... expression of the luciferase reporter plasmid followed by measurement of luciferase activity after lysing cells with Bright-Glo Luciferase Assay System (Promega #E2610), both using Biotek Cytation 5 plate reader ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2021Quote: DNA constructs were transcribed and translated in vitro in pairs using equimolar plasmids in 70 μL of TNT® Quick Coupled Transcription/Translation System (Promega). RNaseOUT (0.5 ΜL ...
-
bioRxiv - Cell Biology 2021Quote: ... Then a digoxigenin-labeled probe against sox846 was transcribed in vitro by using this linearised plasmid as a template and by following the instructions of a commercial in vitro Transcription System (Promega P1420). Templates for WT α-Tubulin-GFP (Addgene 56450) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were reverse-transfected at the day of seeding with 17µg of plasmid either coding for eGFP-RNF213 or eGFP-RNF213-ΔC using 51 µL of Fugene® HD (#E2311, Promega) for a ratio of 1:3 (µg cDNA / µL transfection reagent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and cells with approximately 70-90% confluency in each plate were transfected with required plasmid(s) for each assay using Fugene 6 transfection reagent (Promega, USA) or 1 mg/ml PEI (polyethyleneimine).
-
bioRxiv - Microbiology 2020Quote: ... The amplified signal peptide fragments were introduced into the plasmid pSUC2 (Prof. Sophien Kamoun, The Sainsbury Laboratory) using T4 DNA ligase (Promega, USA). The yeast invertase assay was used to validate the signal peptides (Jacobs et al ...
-
bioRxiv - Microbiology 2020Quote: Plasmids encoding each vector were transfected into HEK293 cells seeded in 10 cm plates using Fugene 6™ (Promega, Madison, WI) or polyethyleneimine ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA fragments generated by PCR were cloned into the pGEM-T Easy plasmid vector using the pGEM®-T Easy Vector System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... mRNA for each chimeric Lep protein was produced from plasmids using the RiboMAX RNA production system in accordance with the manufacturer’s instructions (Promega, Madison, WI). Lep proteins were then produced from mRNA by in vitro translation using rabbit reticulocyte lysate (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Biophysics 2019Quote: ... MDA-MB-231 cells were stably transfected with the plasmids coding for 3-phosphoinositide-specific Akt-PH domain fused with CFP and the plasmids coding for Rac1 fused with YFP using FuGENE® HD transfection reagents (Promega). MCF-7 cells and MDA-MB-231 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Synthetic Biology 2019Quote: Measurements of luminescence intensity from the amber initiator plasmid system was performed as before15 using the NanoYGlo Luciferase Assay System kit (Promega, #N1110) with the following modifications ...
-
bioRxiv - Cell Biology 2020Quote: Transfections were carried out with 1 μg of total DNA (500 ng for each construct or with empty expression plasmid) and 3 μl of FuGENE ® HD Transfection Reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 50 ng of an IFNβ promoter reporter plasmid (p125-luc) and 20 ng of a Renilla luciferase reporter (pRL-TK; Promega E2241) under control of a thymidine kinase promoter were co-transfected ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmid DNA input was produced by midi prepping an overnight culture of 200 mL LB with the appropriate strain (Promega, A2492) and cleaned again using PCR cleanup (Promega ...
-
bioRxiv - Immunology 2020Quote: EPC cells were seeded in 24-well plates overnight and cotransfected with various plasmids using FuGENE HD Transfection Reagent (Promega, #E2311) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... YFP-NLS plasmid was digested by BamHI and HindIII and purified by Wizard® SV Gel and PCR Clean-Up System (Promega). Annealed oligonucleotides encoding UPF1’s NES with HindIII and BamHI overhangs at the end (UPF1-NES wt ...
-
bioRxiv - Bioengineering 2022Quote: ... the mCherry coding sequence was PCR amplified from the plasmid pGFP-bait-MCS-NTR-mCherry using GoTaq® DNA Polymerase (Promega) with primers listed in Supplementary Table S3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250 ng of the pGL3-promoter vector (or the constructions derived from it) and 125 ng of the pCMV-β-gal plasmid (Promega) were used for transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... cRNAs were in vitro transcribed from linearized plasmid DNA templates using RiboMAXTM Large Scale RNA Production System (Promega, Madison, WI, USA). Xenopus oocytes were injected with 50 nl of RNase-free water containing 1.0 ng of cRNA (at a 1:1 molar ratio for heteromeric receptors ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PX459-DNMT1-gRNA plasmid was then used to transfect 293T cells using FuGENE HD Transfection Reagent (E2311, Promega, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... NLS-NSD2-mVenus WT and T1150A plasmids were transfected into 70 % confluent HEK293 SETD2 knockout cells using FuGENE® HD Transfection Reagent (Promega). NLS-mVenus empty vector was used as a negative control ...
-
bioRxiv - Neuroscience 2022Quote: ... mP1/mP2 and the variants were purified from transformed bacteria grown in large-scale bacterial culture (50 mL Midiprep, PureYield™ Plasmid Midiprep System, Promega). The midipreps were made according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... The total amount of transfected DNA was kept equal by supplementing with pCI plasmid DNA (Promega, Madison, United States of America). For electrophysiological recordings ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid pFL61 harbouring the construct RiSKC3-GFP under the control of the PGK promoter was purified from StellarTM bacteria using the PureYield™ Plasmid Miniprep System (Promega). The yeast transformation protocol was described by (50).