Labshake search
Citations for Promega :
101 - 150 of 1522 citations for 5 Methylsulfamoylmethyl 1H indole 3 carboxylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then the total cholesterol was quantified using the Cholesterol/Cholesterol Ester-Glo Assay Kit by Promega (J3190), according to the manufacturers instructions.
-
bioRxiv - Neuroscience 2021Quote: ... 67 µM amino acid mixture (Promega), 1x cOmplete protease inhibitors EDTA-free ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid mix lacking Met (Promega) and 0.1 × volume of an in vitro transcribed mRNA (200-1,000 ng/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 μM amino acid mix (Promega), and 2mM DL-dithiothreitol ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 μM amino acid mixture (Promega), 50 μM Spermidine ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μM amino acids mixture (Promega), 1 u/μl RiboLock RNase inhibitor (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 μM amino acids (Promega PRL4461), 255 μM spermidine ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 µM amino acid mixture (Promega), 900 ng HiBiT mRNA ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Biophysics 2024Quote: ... labeling of TRPV1exCellHalo was completed in the imaging chamber by incubating cells with 3 μM Alexa660 Halo Ligand for 5 minutes (Promega, WI) in HBR followed by 3 minutes of continuous rinsing with HBR perfusion.
-
bioRxiv - Molecular Biology 2024Quote: ... the hdhfr positive selectable marker cassette was PCR amplified from the vector pL-6_eGFP(64) with primers hdhfr 5’ F and hdhfr 3’ R and cloned into pGEM-3Z (Promega, Madison, WI) digested with HincII ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and 5% input were analyzed by qPCR using locus specific primers (Table 3) and SYBR Green Master Mix (Promega, A6002). IP DNA values were normalized to input using the following formula ...
-
bioRxiv - Plant Biology 2020Quote: ... Bisulfite conversion was performed using the methyl edge bisulfite conversion system exactly as described by the manufacturer (Promega, USA). Four overlapping PCR primers (Bs-1F/1R ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Biophysics 2022Quote: ... eGFP was purified and labeled with halotag Succinimidyl Ester (O4) ligand as previously described (Huang et al., 2017) (Promega).
-
bioRxiv - Cell Biology 2022Quote: Total amounts of free cholesterol and cholesterol esters were determined in mouse islet lysates as per the manufacturer’s instructions (Promega). Phosphatidylserine levels were measured in mouse islet lysates as per the manufacturer’s instructions (LSBio).
-
bioRxiv - Neuroscience 2023Quote: ... Equal volumes of homogenized tumor specimens were subsequently subjected to Cholesterol/Cholesterol Ester-GLoTM assay (#J3190, Promega, Madison, WI) and Free Fatty Acid assay (ab65341 ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Biochemistry 2022Quote: The 4330bp PCR product amplified from M13mp18 by using primers: oM13-5-27 and oM13-3-24 was inserted into pGEM®-T Easy(PROMEGA #A137A). The resultant plasmid is named as pM13 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA). A standard curve was generated by determining the copy numbers derived from serial dilutions of the plasmid (103–109 copies) ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were developed with a commercial solution of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) according to the manufacturer (Promega, Madison, WI), in alkaline developing solution ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Maxwell nucleic-acid extraction instrument (Promega). Nanodrop quantified RNA was checked by Bioanalyzer RNA 6000 Nano Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 μM amino acids minus methionine (Promega), 1 μM Ipom-F ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.02 mM of each amino acid (Promega), 33% RRL (Promega ...
-
bioRxiv - Biophysics 2020Quote: ... 10 μM amino acids mixture (Promega, L4461), 1 U μL−1 murine RNase inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 µM amino acid mix (complete, Promega), 4 U RNaseIn plus Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 1 mM ethylenediaminetetraacetic acid (EDTA, Promega). The culture was then induced with 2 mM ZnCl2 and a 1 mL-sample was collected at 5 ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μM amino acids minus methionine (Promega), 6.5% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... The Diamond™ Nucleic Acid Dye (Promega) staining was used to visualize DNA on the gel ...
-
bioRxiv - Biochemistry 2024Quote: ... supplemented with Complete Amino Acid Mixture (Promega), potassium acetate (Promega) ...