Labshake search
Citations for Promega :
101 - 150 of 2513 citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The brain surface was covered in 2-3% low melting point agarose (Promega, Madison, WI) in sterile saline and then capped with silicone elastomer ...
-
bioRxiv - Plant Biology 2024Quote: RNAs including 5’ and 3’ UTRs were synthesized in vitro using T7 RNA polymerase kit (Promega). cDNA from A ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 hours incubation at 37 °C) and 5 μg of trypsin (Trypsin Gold from Promega, in 50 mM TEAB pH 8.5 ...
-
bioRxiv - Genetics 2024Quote: ... 1x or 2x TAE (Tris base, acetic acid, ethylenediaminetetraacetic acid; Promega) buffered agarose gel electrophoresis was used to separate the DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 hours at 37°C and boosted with an extra 2µl Trypsin/LysC (Promega V5073: 20ug + 80uL 50mM acetic acid) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild type or mutant 3′-UTR of DKK3 was cloned into the psicheck-2 vector (Promega). HCT116 cells were transfected with and wild-type or mutant 3′-UTR-luc by using Lipofectamine 3000 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2-3 μg of the purified RNA was in vitro translated using wheat germ extract (Promega) at 25 °C for 2 h as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... LUC images were taken 2-3 days after infiltration by applying 1 mM Beetle luciferin (Promega) on adaxial leaf surface.
-
bioRxiv - Plant Biology 2020Quote: ... using 3 - 5 μg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μM amino acids (Promega), 0.21mM spermidine ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Cell Biology 2021Quote: ... The 4% PFA was removed from the samples with 3 washes of PBSTriton (0.1% Triton-X-100 (Promega: H5141) in 1x Phosphate Buffered Saline (PBS) ...
-
bioRxiv - Biophysics 2024Quote: ... that was blocked for 2 hours in 5% milk TBST before being probed with (Promega) (CS2006A01 clone 30E5 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Bioengineering 2024Quote: ... control and printed aggregates were collected for 4 hours and 3 days post-printing and tested following the CellTiter96 (Promega) assay protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Biophysics 2024Quote: ... UCSD) was transiently transfected into RPE1 cells to labeling peroxisomes for 2 or 3 days using Viafect (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Fugene HD (Fugene HD [μL]:DNA [μg]:DMEM [μL] = 5:2:200;Promega, Madison, WI, USA) was used for transient transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.5 µg (HEK293A, HEK293T, HEK293AΔARRB1/B2) or 2 µg (HEK293AΔGs, HEKS293AΔGi) Glo-22F cAMP plasmid DNA (Promega) and 2 µg MOCK DNA (HEK293A ...