Labshake search
Citations for Promega :
1251 - 1300 of 1317 citations for Recombinant Human C mer Proto Oncogene Tyrosine Kinase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Mitochondrial activity of C-33A cells was measured with the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) (Promega, Madison, WI). Cells were seeded in 96-well plates (5000 cells/well ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting protein samples were diluted to a final concentration of 2M Urea using 20 mM HEPES (pH 8) and digested overnight at 37°C using sequencing grade modified Trypsin (Promega, Madison, WI) in a 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... The light production was then monitored at 20-minute intervals at 37 °C for 2 hours using the Glomax 20/20 Luminometer (Promega, Madison, WI). A final measurement was also taken after the samples had been allowed to incubate overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then incubated for 24 hours at 37°C in 5% CO2 and the luciferase activity was measured using the ONE-Glo™ luciferase assay (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were incubated at 37°C in 5% CO2 for 24 hours and luciferase activity was measured using a ONE-Glo™ luciferase assay (Promega, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... for 30 min at 37°C with shaking at 500 rpm in 500 μl of PBS with RNasin® Ribonuclease Inhibitors (Promega, #N261B). Negative control samples comprised 5 μg of RNA combined with HisPur Cobalt Resin (see details below) ...
-
bioRxiv - Microbiology 2021Quote: ... The CaptureSelect Biotin anti-C-tag Conjugate (LifeTechnologies #7103252100; 1/4000) was mixed with Streptavidin Alkaline Phosphatase (Promega #V5591; 1/1000 dilution) for 10 minutes before use ...
-
bioRxiv - Cancer Biology 2020Quote: ... and diluted to 1 M urea with 200 mM ammonium bicarbonate for trypsin digestion (1 µg, 37°C, 8 hr, Promega cat # V5113). After digestion ...
-
bioRxiv - Neuroscience 2022Quote: ... we transferred the beads to 100 µL 50 mM Tris-HCl buffer with mixed with 1 µg trypsin/Lys-C (Promega Cat# V5073) per replicate ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM ABC was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Cell Biology 2020Quote: To compare Promega’s NanoBiT system β-arrestin2 was inserted at the C-terminal end of LgBiT using Promegas pBiT1.1-N vector (Promega Cat. #N2014) and the doubly palmitolyated fragment of GAP43 was inserted at the N-terminal of SmBiT using the pBiT2.1-C vector.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated with chemical treatments for 18 hours at 37°C prior to rinsing with PBS and lysing with 1x cell lysis buffer (Promega, Madison, WI). Luciferase activity was measured using a Berthold Centro XS3 LB 960 microplate luminometer with automatic injection of Luciferase Assay Reagent (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The band was cut and washed before the in-gel digestion of the proteins overnight at 37°C with a solution of modified trypsin (sequence grade, Promega, Charbonnières, France). The resulting peptides were extracted from the gel by one round of incubation (15 min ...
-
bioRxiv - Microbiology 2019Quote: ... we replaced the C-terminal V5 tag with either HaloTag or NanoLuc (NLuc) from the NanoBRET Nano-Glo Detection System (Promega, Madison, WI). As a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested O/N at 37°C with mass spectrometry grade lysyl endopeptidase LysC and sequencing grade modified trypsin (Promega LTD, UK).
-
bioRxiv - Synthetic Biology 2020Quote: ... and the bound proteins were subjected to on-cartridge digestion with mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega, Madison, WI) at 70°C for 2h ...
-
bioRxiv - Pathology 2021Quote: ... 30 μg of protein was digested with Lys-C (FUJIFILM Wako Chemicals Europe GmbH, Germany) for 4 h and subsequently with modified porcine trypsin (Promega, WI, USA) for 16 h at 37 °C.
-
bioRxiv - Molecular Biology 2021Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega Cat. No. V5111). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and incubated overnight at 25 °C or endoproteinase GluC in a GluC/protein ratio of 1/20 (w/w) (Promega Cat. No.V1651) and incubated overnight at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: Protein samples were alkylated with 10 mM iodoacetamide in the dark at 37°C for 30m and subsequently digested with trypsin (Promega, 50 ng) overnight at 37°C ...
-
bioRxiv - Plant Biology 2022Quote: ... and alkylation treatment (100 mM iodoacetamide / 45 min incubation at room temperature) were followed by 16 hr incubation at 37°C with sequencing grade trypsin (Promega, Madison WI). Tryptic peptides were acidified with formic acid ...
-
bioRxiv - Physiology 2022Quote: ... protein samples were digested by incubated overnight at 37°C with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin). Samples were acidified using 5% TFA and peptides cleaned up using the Phoenix 96× kit (PreOmics ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Zoology 2022Quote: ... The mixture was diluted with 150 μL of 50 mM Tris-HCl pH8.0 and digested by adding 500 ng Trypsin/Lys-C mix (Promega, Madison, WI, USA) overnight at 37 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM TEAB was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was extracted at the NCPHL from subcultures inoculated with single bacterial colonies and grown in nutrient agar (Oxoid, USA) at 37°C overnight according to the manufacturer instructions (Wizard® Genomic DNA Purification kit, Promega, UK). Genomic DNA samples (derived from 10 environmental and 250 clinical samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Systems Biology 2023Quote: ... and the bound proteins were subjected to on-cartridge digestion with mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega, Madison, WI) at 70°C for 2h ...
-
bioRxiv - Biochemistry 2023Quote: One-hundred microliters of 50 mM Tris-HCl (pH 8.0) and 500 ng of trypsin/Lys-C mix (Promega, cat. no. V5072) were added to the washed HaloTag ligand plate following the first-generation assay and mixed gently at 37 °C overnight to digest the proteins ...
-
bioRxiv - Microbiology 2024Quote: ... culture supernatants were frozen at −s80°C and macrophages were processed according to the Promega E1500 Luciferase Assay System protocol (Promega, Madison, WI). Cells were lysed and incubated with D-Luciferin substrate for 5 min in white Lumitrac™ plates (Greiner Bio-one ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Microbiology 2020Quote: ... plates were incubated at 37°C for 72 hours prior to assessing luciferase activity using the Renilla-Glo Luciferase Assay System (Promega, Madison, WI, USA). Readout of eGFP was done by incubating and monitoring plates at 37°C for 72h in an IncuCyte® (Essen BioScience Inc. ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was prepared from a single colony cultured overnight at 37°C in LB using the Maxwell 16 system (Promega Corp., Madison, WI). Libraries for Illumina sequencing were prepared using either Nextera XT (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega, Madison, WI, USA). A second incubation with the same amount of trypsin (5 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... for 20 min at 56°C before DNA was purified with Maxwell® RSC Blood DNA Kit (Promega Pte. Ltd., Cat. No. AS1400). DNA concentration was quantified using Qubit® 2.0 fluorometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... and the RNA was precipitated with an equivalent volume of isopropanol and incubated at 55°C for 10 minutes before being resuspended in 50 μL of RNase-free water (Promega, Madison, WI, USA). We determined the concentrations of RNA using a Smart-Spec plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... collected by centrifugation (17,000 g for 10 min at 4°C) and solubilized in 20 μl 50 mM TEAB containing 0.2 % ProteaseMAXTM Surfactant (Promega UK Ltd, Cat. # V2071) for 1-2 h with vortex and occasional sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transfected cells were cultured at 37°C for 36 h and subjected to luciferase activity analysis using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Cell Biology 2019Quote: ... containing T7 promoter at the 5’ end at 37 °C using the T7 RiboMax Express Large-Scale RNA Production System (Promega Corp., Madison, WI), following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...