Labshake search
Citations for Promega :
801 - 850 of 1317 citations for Recombinant Human C mer Proto Oncogene Tyrosine Kinase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Biochemistry 2021Quote: ... for 1 h at 37°C (sample to enzyme ratio 1:20) and then with GluC (Promega) (1:40 ratio ...
-
bioRxiv - Immunology 2021Quote: ... 50 mM Tris-Cl (pH 8) prior to digestion with Trypsin/Lys-C Mix (Promega, Madison, WI) at a ratio of 1:25 (enzyme ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was prepared from bacterial cultures grown at 37 °C using PureYield™ Plasmid Midiprep System (Promega) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... and samples were digested over night with Lys-C (Wako) followed by 4h digestion with Trypsin (Promega) at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... the samples were incubated overnight at 37°C with 0.01 μg/μL of trypsin (Promega, Madison, WI) and dissolved in 50 mM ammonium bicarbonate ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were reduced and alkylated followed by overnight digestion at 37°C using LysC / Trypsin proteases (Promega) and isobaric labelling using tandem mass tags (TMT ...
-
bioRxiv - Microbiology 2023Quote: ... the modified region was amplified using primer SAM_Seq_Gen-23_FW (5’-GAT TTG AGG ACG ACT GGA CTG C) and SAM_Seq_Gen1116_RV (5’-GTC AAC TGA ACA ACC CCA AGG T) together with GoTaq polymerase (Promega), followed by cloning into pGEM T-easy vector system (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested in-gel overnight at 37°C with Sequencing Grade Modified Trypsin (Promega; cat. #V5111) diluted in 200uL of digestion buffer (40 mM ammonium bicarbonate ...
-
bioRxiv - Systems Biology 2023Quote: ... then proteins were digested with 1 μg of mass spectrometry grade Trypsin/Lys-C enzyme mix (Promega) in 50 μL of digestion buffer (100 mM ABC ...
-
bioRxiv - Cell Biology 2023Quote: ... digested overnight at 37°C in the presence of 1.5 µg of sequencing grade modified trypsin (Promega). The resulting peptides were vacuum-dried in a vacuum concentrator to approximately 200 µL ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were digested overnight (21 h) at 37 °C with 0.1 μg/μL trypsin (sequencing grade, Promega) dissolved in 1 mM HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... on-column trypsin digestion was performed by adding by mass spectrometry grade trypsin/Lys-C mix (Promega) in a 50 mM NH4HCO3 buffer overnight at 37 °C.
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated overnight at 37°C with sequencing grade modified trypsin (0.01 mg/mL; Promega Corporation) to allow protein digestion ...
-
Pan-tissue mitochondrial phenotyping reveals lower OXPHOS expression and function across tumor typesbioRxiv - Biochemistry 2023Quote: ... 1mM CaCl2 for overnight digestion via trypsin at 32°C (Promega, Cat# V5113; 1:50 w:w enzyme:protein). Following digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then subjected to digestion with LysC (Wako) at 37°C for 2h and trypsin (Promega) overnight at 37°C at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Genetics 2024Quote: ... then a 5 min final extension (72 °C)—was carried out with GoTaq Green Master Mix (Promega). Deletion loci from mutant flies were amplified using the genotyping primers above with four GoTaq Green PCR reactions per line ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples were further digested overnight at 37 °C with the addition of sequencing grade chymotrypsin (Promega) to a final protease:protein (w:w ...
-
bioRxiv - Pathology 2024Quote: ... at a 1:50 wt:wt ratio alongside Lys-C at a 1:25 wt:wt ratio (Promega, VA1170) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2024Quote: ... alkylated with 10 mM iodoacetamide and subject to sequential protein digestion with Lys-C and trypsin (Promega). Digestion was halted with formic acid ...
-
bioRxiv - Genomics 2024Quote: ... We amplified the Cytochrome c oxidase subunit I (COI) for individual abdomen DNA using the GoTaq (Promega) protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...