Labshake search
Citations for Promega :
1251 - 1300 of 4906 citations for 7 8 Dimethoxy 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 μL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 μL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the tRNA pellet was resuspended in water and incubated with 8 U of RQ1 RNAse-free DNAse (Promega) at 37 °C for 30 min according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... HMW DNA was resuspended in 10 mM Tris pH 8 and quantified by Quantus™ Fluorometer (Promega Inc). The DNA size and integrity were assessed on TapeStation™ instrument (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µl of the RT product (diluted 1:5) was used for semi-quantitative PCR or qPCR reactions with Promega PCR Mix (Promega, Madison, Wisconsin, USA) and SYBR Green PCR Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... knowlesi elongation factor-1 alpha (pkef1-alpha) 5’ UTR were isolated from agarose gels and cloned into the pGEM-T vector (Promega, Madison, WI, USA). To replace the pfcam 5’ UTR sequence that drives luciferase transcription in the pD-pfcam-Luc ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... The drug and media were refreshed on day 3 and cell viability was assessed in the cell lines as compared with the vehicle condition (0.1% DMSO) at 7 days post treatment using MTS reagent (Promega, Madison, WI, USA). IC50 values were determined in the cell lines by dose-response curves calculated using the drc (v3.0.1 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...