Labshake search
Citations for Promega :
1201 - 1250 of 4906 citations for 7 8 Dimethoxy 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of nuclease free water (Promega, Cat No. P119E), and 5 µl of cDNA using the following program ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were suspended in 10 mL MACS buffer (2% FBS, 2 mM EDTA (Promega, V4231) diluted in phosphate-buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 ng of pRL-SV40 (Promega) Renilla luciferase construct was added to the 384-well reporter library plates and incubated for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... NanoBRET Tracer 5 (Promega, Madison, WI, USA) was used at a final concentration of 1.0 μM as previously evaluated in a titration experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HaloTag TMR Ligand (5 mM) (Promega) were dissolved in DMSO (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μM HaloTag-TMR substrate (Promega) and incubated for 15 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 µg of K562 cell lysate (Promega) or 5 µg yeast digests were injected and run on a nanoAcquity UPLC (Waters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 5 % BrightGlo (Promega, Madison, WI, USA) before reading luminescence on a Molecular Devices SpectraMax iD5 with a 1 second integration time ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg of trypsin (Promega, Sequence Grade) was added and digestion was performed overnight at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Trypsin (5 μg/ml trypsin gold (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... 4.0 µL of 5× GoTaq Buffer (Promega), 2.0 µL of MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μl of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL GoTaq polymerase buffer 5x (Promega), 0.5 μL of each primer ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 5 minutes with AttoPhos (Promega). Images were acquired with a FLA-5000 fluorescent image analyzer (Fujifilm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5% pRL-TK Luc (Promega E2241) plasmid and 100 µL of the transfected cell suspension were seeded into a white PDL-coated 96-well flat bottom plate (Nunc) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples containing 5-10 µg of protein were mixed with 0.25-0.5 µg BSA (used as an internal standard in this analysis) and cleaved with 1 µg trypsin/LysC mix (Promega, Madison, WI) using the SP3 beads protocol described in (Hughes et al. ...
-
Photoreceptor disc incisures form as an adaptive mechanism ensuring the completion of disc enclosurebioRxiv - Cell Biology 2023Quote: ... Samples containing 20 µg of protein were mixed with 0.5 µg BSA (used as an internal standard in this analysis) and cleaved with 1 µg trypsin/LysC mix (Promega, Madison, WI) using the SP3 beads protocol described in (Hughes et al. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Biochemistry 2021Quote: ... and the “on-bead-digestion” plate (100 μl 20 mM Tris pH 8.5, Sigma-Aldrich 10708976001, 1 μg/mL LysC, Wako 129-02541, 2 μg/mL Trypsin, Promega V5111). The programmed sequence is ...
-
bioRxiv - Microbiology 2022Quote: ... then diluted 1:5 with nuclease-free water before 2 µL was used as template in a 10 µL GoTaq 1-Step RT-qPCR (Promega, A6020) reaction (69) ...
-
bioRxiv - Developmental Biology 2022Quote: ... for the duration of imaging (approximately 2 minutes per embryo) with the yolk supported in a shallow well of solidified 1% low-melting agarose (Promega, V2111). Adult fish were photographed using a Panasonic DMC GX7 camera with a Panasonic Lumix G 20mm pancake lens ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either anti-rabbit (1:5000, Promega W4011) or anti-mouse HRP (1:5000 ...
-
bioRxiv - Immunology 2024Quote: ... mice were humanely killed by xylazine/ ketamine overdose and lungs inflated with 1 ml of 2% low melting temperature agarose (Promega, US) at 37 °C ...