Labshake search
Citations for Promega :
1251 - 1300 of 4574 citations for 6 CHLORO 2 METHYLIMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... Caspase 3/7 activity was then quantified using the Apo-One Homogenous Caspase-3/7 assay (Promega).
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was measured using the Caspase-Glo® 3/7 Assay System (G8090, Promega) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The primer pair (5′- accagacggagtttgagcgcgtcttcTGAGGAGGATCCGGTGGAGCTAGCGGAAGA-3′ and 5′-ctccaccgagtcgtactgcttcgccatACCAGAATTCCCACCGCTCGAGCCA-3′) and pBit3.1-N (Cat. No. N2361, Promega) were used to clone the vector-containing fragment ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-3 and -7 activities were measured using the Caspase-Glo 3/7 assay kit (Promega, G8090) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... using primers 5’-TCCCTTCCTTCAAGGCTACA-3’ and 5’-GTTAGGAGCCAGAGCAGCAC-3’ and the Go-Taq Flexi DNA Polymerase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes are synthetized from a PCR product or a linearized plasmid (see Table 2) with the T7 or SP6 RNA polymerase (Promega, P4074 or P4084) in presence of DIG-UTP nucleotides ...
-
bioRxiv - Systems Biology 2019Quote: ... the cells were immediately re-plated in 2 ml of complete medium for 24 hours and then lysates were analyzed with the Dual Luciferase reporter system (Promega Catalog No. E1910).
-
bioRxiv - Biochemistry 2019Quote: ... The beads were again washed with 50 mM ammonium bicarbonate buffer and resuspended in 100 µl of fresh 50 mM ammonium bicarbonate buffer and treated with 2 µg of sequencing grade modified trypsin (Promega; Product code V5113) at 37 oC overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA samples (2 μg) were used for the synthesis of cDNA by reverse transcription using GoScript ™ Reverse Transcriptase (Promega, Madison, USA). RT-PCR was performed with a CFX96 Touch ™ Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2021Quote: Hela cells were transfected with 2 µg of HaloTag® fusion construct and 20 ng NanoLuc® fusion construct using Fugene® HD (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 x 105 U2OS cells were transfected with 2 µg of sgRNA and Cas9 expressing plasmid using Fugene HD reagent (Promega, Madison, WI, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used in this study were as follows ...
-
bioRxiv - Physiology 2019Quote: ... The wounded area and its surrounding area (2 x 2 cm) were immediately dissected out and RNA extraction was conducted using Maxwell® RSC simplyRNA Tissue Kit (AS1340, Promega, Madison WI) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein mixture was diluted to 25mg/ml with 50mM ABC and 500ug of protein were digested with 2% w/w Trypsin (Promega, Cat. no. V5111) in 1mL of 50mM ABC overnight at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... this template was generated from the cDNA of SARS-CoV-2 AI/I-004/2020 using the T7 RiboMAX Express Large Scale RNA Production System (Promega, Madison, WI, USA). The primers and probe used to detect the WK-521 strain were as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... viable cells were quantified in a FLUOstar OPTIMA ELISA reader (550/590 nm) about 2 h after CellTiter-Blue staining (Promega, Cat No. G8081). Mean values +/-standard deviations (SD ...
-
bioRxiv - Plant Biology 2023Quote: ... and 2 µg of RNA were used for reverse transcription into complementary DNA (cDNA) using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... was synthesised from 2 µg of total RNA using the Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT; Promega, Madison, WI, USA) using random primers and oligo-dT primers (3:1 mol ...
-
bioRxiv - Cell Biology 2023Quote: Affinity purified proteins retained on beads were resuspended in 100 µL of NH4HCO3 at 25 mM containing 2 µg of Trypsin/Lys-C mix (Mass Spec Grade, Promega, Madison, WI, USA). Digestion was performed under agitation at 37°C during 4h ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, Cat. no. V5117) directly on top of the column and incubating overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... beads were equilibrated in 50 mM of ammonium bicarbonate with 2 washes followed by on-bead digestion with trypsin (800 ng; Promega cat. nr. V5280) overnight at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... A 15-amino acid linker and SmBiT subunit (peptide 86, Promega) were attached to the C-terminus of rat Gβ1 ...
-
bioRxiv - Immunology 2022Quote: ... the Maxwell Viral Total Nucleic Acid Purification kit (Promega, Madison, WI) was used to isolate viral RNA (vRNA ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extracts were treated using RQ1 RNAse-free DNAse (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and subsequently stained with Diamond™ Nucleic Acid Dye (Promega, H1181) for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... a complete standard mixture of amino acids (Promega, Medison, WI, USA) was analyzed by CE-MS to obtain MS and MS/MS spectra of the proteinogenic amino acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Physiology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3 and/or 7 activity was assessed with Caspase-Glo 3/7 assay purchased from Promega (G8090).
-
bioRxiv - Immunology 2020Quote: ... the Caspase 3/7 activity of hemocytes was determined with the Caspase-Glo 3/7 assay (Promega, USA). While the apoptosis rate was evaluated using FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM ...