Labshake search
Citations for Promega :
1051 - 1100 of 4574 citations for 6 CHLORO 2 METHYLIMIDAZO 1 2 A PYRIDINE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and 10 μM methionine-free amino acid mixture (Promega). The Click-iT reaction was performed with the Click-&-Go Protein Reaction Buffer Kit (Click Chemistry Tools ...
-
bioRxiv - Systems Biology 2019Quote: ... and 50 μM of each amino acid (Promega, #L446A). T7 RNA polymerase (NEBs ...
-
bioRxiv - Cell Biology 2021Quote: ... 14 μM amino acid mix w/o methionine (Promega)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained in Diamond Nucleic Acid Stain (Promega, H1181). All experiments were performed in 8-12 week old animals ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected in a 3:1 ratio of FuGENE® HD Transfection Reagent (Promega cat # E2311) and plasmid DNA (pcDNA3.1-HMGB1P1-3xHA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase-3 and -7 activity was measured by Caspase-Glo 3/7 Assay (Promega) according the manufacturer’s instructions using a BioTek Synergy H1 plate reader.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega) and caspase activity was normalized to cell number by performing the CellTiter-Glo Luminescent Cell Viability Assay on the duplicate plate.
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was determined with the Caspase-Glo 3/7 assay (Promega), and caspase activity was normalized to cell number by performing the CellTiter Glo Luminescent Cell Viability Assay on the duplicate plate ...
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and -7 activities were measured by Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... Caspase-3/7 activities were measured using Caspase-Glo 3/7 Assay kits (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μg of purified RNA was incubated with 3 units of RQ1 DNase (Promega) at 37°C for 30 mins ...
-
bioRxiv - Bioengineering 2021Quote: Caspase 3/7 activity was measured using the Caspase-Glo 3/7 assay (Promega). Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... caspase 3 activity was measured using Caspase-Glo 3/7 assay (Promega, Alexandria, Australia). Quantification of viable cells was performed by staining with 7-aminoactinomycin D (7-AAD ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein digestion was performed by 1 µg of Lys-C (Wako) at 37 °C for 3 h following 1 µg of trypsin (Promega, Madison, WI, USA) at 37 °C for 16 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3/7 Glo (Promega) was used to measure caspase 3/7 cleavage ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 units/mL RNasin (Promega). Depending on the experiments (see results) ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 ng of each of the donor and Cas9-sgRNA vectors were transfected to RPE-1 cells cultured in 6 wells with 1.5 μl of FuGENE® HD (Promega, E2311) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected the following day using 0.6–1 µg of plasmid and Viafect reagent (Promega E4981, 6 µl/µg plasmid). The medium was exchanged the following day to regular culture medium ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the treatment was removed from the wells and the cells were incubated with 100 μl of EGM™-2 complete medium with 20 mM HEPES and 20 μl of MTS (Promega, CellTiter 96® AQueous One Solution Reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...