Labshake search
Citations for Promega :
1201 - 1250 of 1318 citations for 7 Chloro trans 2 hepenoic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Developmental Biology 2022Quote: ... for the duration of imaging (approximately 2 minutes per embryo) with the yolk supported in a shallow well of solidified 1% low-melting agarose (Promega, V2111). Adult fish were photographed using a Panasonic DMC GX7 camera with a Panasonic Lumix G 20mm pancake lens ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either anti-rabbit (1:5000, Promega W4011) or anti-mouse HRP (1:5000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the treatment was removed from the wells and the cells were incubated with 100 μl of EGM™-2 complete medium with 20 mM HEPES and 20 μl of MTS (Promega, CellTiter 96® AQueous One Solution Reagent ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2024Quote: ... mice were humanely killed by xylazine/ ketamine overdose and lungs inflated with 1 ml of 2% low melting temperature agarose (Promega, US) at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 μL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 μL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of the lysed samples were added to 25 µl PCR reactions with GoTaq Green mastermix (Promega, Cat. No. M7123). After amplification ...
-
bioRxiv - Physiology 2024Quote: ... further steps were performed according to the manufacturer’s protocol using proteases trypsin and Lys-C (2 h at 47° C, 1:15 and 1:30, respectively, Promega, USA). Peptides (20 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of RNA was used astemplate to generate cDNAs using the ImProm-II Reverse Transcription system (Promega, Madison, Wisconsin, USA). qPCR reactions were carried out on an MX3000P system (AgilentTechnologies ...
-
bioRxiv - Microbiology 2024Quote: ... Contaminating DNA in the samples were removed through incubation at 37°C for 2 h using RNase-free DNase I (Promega, USA). All RNAs in the samples were converted into cDNA using a cDNA EcoDry Premix (Clontech ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ml ice-cold wash buffer 1 (1x PBS with 2 % BSA, 1 mM DTT and 0.5 U/µl RNasin® Plus Ribonuclease Inhibitor - Promega #N2615) was added and cells were spun at 500 g for 3 min at 4 C ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was executed in a total of 20μl reaction volume which includes 2 X Mix SYBR green I (10μl; Promega Corporation, Madison, WI, USA), primer (0.25μl ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was monitored every 30 seconds for 2 min using a luminometer (GloMax® 20/20n Luminometer, Promega Italia, Milan, Italy) for the luciferin/luciferase chemiluminescent method ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of pCS2-HA-NFATc3 was incubated for 2 h at 30°C in 50 μl of the TNT® SP6 coupled wheat germ extract system (Promega, #L5030), according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected according to manufacturer instruction with a transfection mix containing a ratio of 1 µg of plasmid for 2 µl FuGene HD transfection reagent (Promega, REF E2311) diluted in DMEM without FCS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein ratio of 1:50 w/w for 2 hours at 37°C and further digested with 30 µL 50 mM TEAB containing trypsin (Sequencing Grade Modified, Promega, Madison, WI) at a trypsin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3’UTR sequences were cloned downstream from the renilla luciferase gene using the XhoI and NotI sites in the siCHECK-2 vector (Promega, Madison, WI). This vector also contains a firefly luciferase gene driven by an independent protomer ...
-
bioRxiv - Neuroscience 2019Quote: ... Gaussia luciferase activity was measured in the dark 0.1 sec after injection of 100 μl/well of 40 mM coelenterazine, substrate (NanoLight, Pinetop, AZ) using a 2 second integration on a Veritas Microplate Luminometer (Promega, Madison, WI). The cells were subsequently assayed for red Firefly activity using the ONE-GloTM Luciferase Assay System kit (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... 2 μg of purified RNA for each sample was used to synthesize cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) at 42°C for 1 h ...