Labshake search
Citations for Promega :
1151 - 1200 of 1318 citations for 7 Chloro trans 2 hepenoic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: The activity of EBV miRs-BART 7-3p and 9-3p was evaluated in Akata-EBV/Cas9 cells by luciferase reporter gene assay with constructs based on the psiCheck-2 backbone (Promega). 3’-UTR sequences with miRNA-binding sites (Supplementary Material ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were detected with a YFP long probe (primers listed in Supplemental Table 2) labeled with 32P-dCTP prepared according to the manual of the Prime-a-Gene Labeling System (Promega). The blot was hybridized overnight at 42 °C with the probe before being washed with 2xSSC ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Microbiology 2023Quote: ... injecting 50 μl per well of coelenterazine substrate (Nanolight Technologies, 2 μg/ml) and analysing luminescence on a FLUOstar OPTIMA luminometer (Promega). Fold inductions were calculated by normalising to a mock-treated control.
-
bioRxiv - Evolutionary Biology 2023Quote: ... reverse transcription was performed using Promega’s Go-Taq 2-Step system with oligo(dT) and randomized primers as per manufacturer’s instructions (Promega, Madison, WI).
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours followed by another overnight digestion with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Blots were then incubated with blotting buffer containing 1:200 LgBiT for 1-2 h with rocking at RT (N2410, Promega). Next ...
-
bioRxiv - Biochemistry 2023Quote: ... pLH3/DTX3L or pLH3/DTX3LΔN) and accessory plasmids pMD2g and psPAX2 (ratio 2:1:1) using ViaFect transfection reagent (Promega E498A). After cell incubation at 37°C for ∼16 h ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Pathology 2024Quote: ... The samples were diluted with 50 mM TEAB buffer to a final Urea concentration of 2 M before adding trypsin (Promega) in an enzyme:substrate ratio of 1:75 and incubating at 25 °C for 16 hours ...
-
bioRxiv - Immunology 2024Quote: ... Blots were incubated with primary antibodies overnight at 4°C followed by 2-hour incubation with HRP-conjugated secondary anti-rabbit IgG-HRP conjugate antibodies (1:10,000; Promega W401B) at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transfection for each well was performed with a mixture of 2 µg of DNA and 6 µL of Fugene HD reagent (Promega). The DNA/fugene mixture was incubated for 15 minutes at room temperature prior to its drop-wise addition to the infected culture ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μL IVT reactions were carried out for 2 hours at 30°C using commercially available Nuclease-Treated Rabbit Reticulocyte Lysate (RRL, Promega) and reaction components were added in the following order ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR fragment was directionally cloned downstream of the Renilla luciferase ORF in the psiCHECK-2 vector (Promega, Madison, US) using the Quick Ligase kit (M2200 ...
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... The annealed oligos were ligated into the Xho I and Not I sites in the 3’UTR of the Renilla luciferase gene in the psiCHECK-2 plasmid (C8021, Promega). Each plasmid was transfected individually into HEK 293 cells with miR-891b using DharmaFECT 1 Transfection Reagent (T-2001-03 ...
-
bioRxiv - Cell Biology 2024Quote: ... Bacmid DNA was extracted from overnight cultures using isopropanol precipitation as described.72 About 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 μg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... The sample solutions were diluted to a final concentration of 2 M urea and 50 mM ammonium bicarbonate prior to the trypsin (Promega) digestion ...
-
bioRxiv - Biochemistry 2024Quote: ... elution buffer I (2 M Urea, 50 mM Tris pH 7.5, 1 mM DTT and 5 ng/µl Trypsin (Promega, #V5111)) were added and samples were incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: In vitro toxicity was assessed in HeLa cells (ATCC® CCL-2) using the ApoTox-GloTM Triplex Assay (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase PRE reporters were generated by inserting PRE repeats into the 3’UTR of Renilla luciferase in the psiCheck-2 dual luciferase reporter vector (Promega) (Table S7) ...
-
bioRxiv - Microbiology 2024Quote: The 3’UTR of human Akt or Pin1 was amplified by PCR from fibroblast genomic DNA and cloned downstream of the Renilla luciferase gene in the psiCHECK-2 dual reporter construct (Promega) by XhoI (Akt ...
-
bioRxiv - Molecular Biology 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21 °C overnight ...
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Biochemistry 2021Quote: ... and the “on-bead-digestion” plate (100 μl 20 mM Tris pH 8.5, Sigma-Aldrich 10708976001, 1 μg/mL LysC, Wako 129-02541, 2 μg/mL Trypsin, Promega V5111). The programmed sequence is ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... then diluted 1:5 with nuclease-free water before 2 µL was used as template in a 10 µL GoTaq 1-Step RT-qPCR (Promega, A6020) reaction (69) ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...