Labshake search
Citations for Promega :
951 - 1000 of 4648 citations for 3 Piperidinol 1 methyl 4 2 4 6 trimethoxyphenyl cis + since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... along with the plasmid of interest using Fugene 6 transfection reagent (Promega). All shRNA plasmids used were purchased from Sigma ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid DNA transfections were performed using FuGENE® 6 transfection reagent (Promega). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega). After overnight incubation at 37°C in 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected using a master mix of Fugene 6 (Promega, E269A) and Optimem (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... These three plasmids were cotransfected into HEK293T cells using Fugene 6 (Promega). Media was exchanged after three days and ultimately collected after five days total then passed through a 0.45μm syringe filter before being stored at -80C.
-
bioRxiv - Neuroscience 2024Quote: ... Cells were grown to 80% confluence and transfected using Fugene 6 (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... they were transfected with indicated plasmids using FuGENE 6 transfection reagent (Promega). After another 24h ...
-
bioRxiv - Biophysics 2024Quote: ... After 6 to 24 hours cells were transfected using Viafect reagent (Promega, Madison ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This method removed cellular material while preserving spicules and the spongin network (if present) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20,000 to 50,000 cells were lysed in the transposase reaction mix (12.5 μl 2xTD buffer, 2 μl TDE1 [Illumina], 10.25 μl nuclease-free water, and 0.25 μl 1% digitonin [Promega]) for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were washed twice with 50 mM HEPES, pH 8.5 (18,000g, 2 x 10min) before they were incubated with 1 μg trypsin (Promega) in 50 mM HEPES ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were seeded in 96-well plates at 3,000-5,000/well in serial 1:2 dilutions for 72 hours and assessed by CellTiter-Glo (Promega). For synergy assays ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA and siRNA transfections were performed using FuGENE 6 Transfection Reagent (Promega) and Lipofectamine RNAiMAX (Invitrogen) ...