Labshake search
Citations for Promega :
801 - 850 of 4648 citations for 3 Piperidinol 1 methyl 4 2 4 6 trimethoxyphenyl cis + since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified by centrifugation (500 x g, 5 min, at 15°C) and mixed 1:1 with 2× passive lysis buffer (Promega cat #E1941). Cell monolayers were washed in PBS and lysed in 1× passive lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL RRV-P3 plasmid or 3 μL of cDNA from rose tissue or nuclease-free water (Promega, Madison, WI). The final volume of the LAMP reaction was 25 μL.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated ∼18 hours at 37°C and individual white colonies screened for insert by colony PCR using primers M13_F (5’-ACGACGTTGTAAAACGACGGCCAGT-3’) and M13_R (5’-ATTTCACACAGGAAACAGCTATGACCA-3’) GoTaq DNA Polymerase (Promega). Reactions were separated by gel electrophoresis ...
-
bioRxiv - Physiology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Caspase 3 and/or 7 activity was assessed with Caspase-Glo 3/7 assay purchased from Promega (G8090).
-
bioRxiv - Immunology 2020Quote: ... the Caspase 3/7 activity of hemocytes was determined with the Caspase-Glo 3/7 assay (Promega, USA). While the apoptosis rate was evaluated using FITC Annexin V Apoptosis Detection Kit I (BD PharmingenTM ...
-
bioRxiv - Genetics 2022Quote: ... The DNM1 amplification was performed with specific primers pair (DNM1_Forward 5’-GGGTCTTGTACGGAGCAGGG-3’ and DNM1_Reverse 5’-GAGTCAGATAGTAAGGGCAAGCAC-3’) using Pfu DNA polymerase (Promega). After the first amplification to select DNM1 fragment of 761 bp ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase-3/7 activity in leukemia cells were detected by Caspase-Glo 3/7 Assay System (G8091; Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo 3/7 Assay Kit (Catalog No. G8091, Promega) for each sample according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was determined using the Caspase-Glo® 3/7 assay (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activities in were assessed by using Caspase-Glo 3/7 assay (Promega Corp., Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caspase-3/7 was quantified using the Apo-ONE® Homogeneous Caspase-3/7 Assay (Promega, Fisher scientific) according to the manufacturer’s protocol ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 Glo (Promega #G8091) were added and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μL of Cell Titer Glo (Promega) were added to each well ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... For the Caspase 3/7 Glo (Promega) assay ...
-
bioRxiv - Biochemistry 2020Quote: ... and Caspase-Glo 3/7 assay (Promega), respectively ...
-
bioRxiv - Zoology 2021Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact.
-
bioRxiv - Cell Biology 2022Quote: ... We added 3 μg Trypsin Gold (Promega) to each sample for digestion and incubated samples at 37°C overnight (approximately 16 hours ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Caspase-Glo 3/7 Assay (Promega) was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: A caspase - Glo 3/7 kit (Promega) was used to evaluate caspase 3/7 activity based on the kit protocol ...
-
bioRxiv - Zoology 2020Quote: ... and 3% 20mg/ml Proteinase K (Promega). Many additional photos of spicules and sections are available in the supplementary data that accompanies this paper ...
-
bioRxiv - Genetics 2020Quote: ... 3 μl of RNasin ribonuclease inhibitor (Promega) per ml of extraction buffer] ...
-
bioRxiv - Molecular Biology 2022Quote: ... For SUMO1-3 thrombin (16 U; Promega) was used for cleavage in buffer (20 mM Tris-HCl pH 8.4 ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Microbiology 2024Quote: ... the Caspase-Glo-3/7 kit (Promega) was used as previously described (22) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ul of RNasin Ribonuclease Inhibitor (Promega) was added to the beads and incubated for 2 hours at 4°C/3rpm ...