Labshake search
Citations for Promega :
51 - 100 of 1011 citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: HEK293 cells (ATCC, Manassas, VA) stably expressing both D3R and GloSensor 22F-cAMP (Promega) were created for these experiments ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293 cells were transfected with the VHL-NanoLuc fusion constructs using FuGENE HD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293-µOR cells were transfected with a plasmid encoding pGloSensor-20F cAMP reporter (Promega). Cells were harvested 24 h post transfection and resuspended at a 1.5x10^6 live cells/ml in assay media (DMEM without phenol red or FluoroBrite DMEM ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1.5 μg receptor and 1 μg GloSensor-22F (Promega). After 24 hours ...
-
bioRxiv - Immunology 2022Quote: ... The constructs encoding EROS/CYBC1 or gp91phox/CYBB fused to the reporter subunits were custom made by Promega and consist of the following ...
-
bioRxiv - Biochemistry 2022Quote: ... Rat Gβ1 with an N-terminal MHHHHHHSSGLVPRGSHMASHHHHHHHHHH-tag (His16) was fused with the SmBiT subunit (peptide 86, Promega)20 via a 15 amino acid (GSSGGGGSGGGGSSG ...
-
bioRxiv - Cancer Biology 2020Quote: ... Triplicate biological replicates were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described68 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quadruplicate biological replicates were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described 60 ...
-
bioRxiv - Neuroscience 2020Quote: Transfected neuronal cultures with the NF-κB reporter Firefly Luciferase plasmid (Cat. N° E1980, Promega, Madison, WI, USA), were stimulated with NMDA/glycine for 60 minutes ...
-
bioRxiv - Neuroscience 2020Quote: Luciferase and β-Gal activity were evaluated in neuronal cell lysates using commercial assay kits (Promega, #E2000, #1500). Luminescence recordings were performed using an Infinite M200 microplate reader with an injector system (Tecan) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were treated for 8 hours with either 0.1 µmoles/L Coumermycin A1 (Promega) or an equivalent volume of DMSO ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293 cells were transfected using FuGeneHD transfection reagent according to manufacturer’s protocol (Promega, Cat # E2311). 48 hours post-transfection ...
-
bioRxiv - Biochemistry 2019Quote: HEK293 was used for transfection of plasmids with FuGENE HD Transfection reagent (Promega, Tokyo, Japan). RIPA buffer was used for obtaining proteins from whole cells ...
-
bioRxiv - Immunology 2020Quote: ... expression constructs were transfected into the HEK293 EBNA cells using FuGENE HD transfection reagent (Promega). After selection with puromycin ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid constructs were acutely transfected into HEK293 cells using Viafect reagent (E4981; Promega, Madison, WI), following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... the His-VqmA was purified using MagneHis Ni-Particles (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Cell Biology 2024Quote: ... HIS-PLK1 used in ADP-Glo was from Promega (V2841). HIS-PLK1 used in Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was initiated by the addition of 1-250 nM acylated peptide (Vivitide) and a 1:10,000 dilution of LgBiT subunit of the NanoBiT luciferase (Promega) and read using an Envision plate reader (XCite 2105 ...
-
bioRxiv - Cell Biology 2024Quote: ... biological replicates (n=7) were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) on beads as previously described (Hubner et al. ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 or MIA PaCa-2 cells were transfected with different AGO2 constructs using Fugene HD (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified BAC and plasmid DNA were transfected into HEK293 cells with FuGene HD transfection reagent (Promega) in a 1:3 DNA:FuGene HD ratio ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 cells were transfected with β1AR and a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... DRG cultures were incubated with an antibody directed against the neuronal-specific marker βIII tubulin (Promega, Madison, WI, United States) diluted 1:2000 in blocking solution ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... Luciferase activity in infected hACE2-HEK293 cells was measured with a Bright-Glo Luciferase assay system (Promega) and a Beckman Coulter DTX880 plate reader ...
-
bioRxiv - Biophysics 2020Quote: ... Changes in the intracellular cAMP concentration of the HEK293 cells were measured by the GloSensor assay (Promega). The transfected cells were incubated with or without 0.5 μM all-trans-retinal (Toronto Research Chemicals) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs (2 μg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were washed with 1X PBS buffer and then lysed with 1X passive lysis buffer (Promega). The cells were cleared of any cell debris by centrifugation at 14000 rpm for 10 min at 4°C ...
-
bioRxiv - Physiology 2022Quote: ... 1.15 μg of purified AQP2 or AQP2 S256A COOH-tail peptide were mixed with either RSK (16 nmol) or PKA catalytic subunit (5.6 nmol) (Promega, Madison, WI) in a total volume of 12 μl reaction buffer containing 40 mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2024Quote: lrl 1μg of N-terminally FLAG-tagged receptor and 1μg of F22 (Promega, Cat. no: E2301) (for GloSensor assay)
-
bioRxiv - Immunology 2023Quote: ... Three biological replicates for each condition were digested with Lys-C (Alpha Laboratories) and trypsin (Promega) “on beads” as previously described [44] ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Systems Biology 2023Quote: HEK293 cells stably expressing μOR or μOR-APEX2 were transiently transfected with the cAMP biosensor pGLO-20F (Promega). Prior to agonist stimulation ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with the same enzymes and ligated with the amplified receptors using T4 DNA ligase (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... The 3xFlag-m-PKD1-2xMyc/His insert was subcloned into pCI vector (Promega). To produce CTF expression constructs of human (h ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biological triplicates were digested with Lys-C (Alpha Laboratories, Eastleigh, UK) and trypsin (Promega, Madison, WI, USA) on beads as previously described (56) ...
-
bioRxiv - Bioengineering 2019Quote: ... cells were transfected using FuGene HD transfection reagent according to their standard protocol for HEK293 cells (Promega, Madison, WI). DNA plasmids were cloned in Dam-negative E ...
-
bioRxiv - Immunology 2020Quote: ... The sleeping beauty transposon system was stably transfected into HEK293 EBNA cells using FuGENE® HD (Promega GmbH, USA) in DMEM/F12 (Merck ...
-
bioRxiv - Biochemistry 2023Quote: The recruitment of PTH1R to β-arrestin was detected in HEK293 cells using the NanoLuc Binary System (NanoBiT; Promega). The Lgbit subunit was fused to the C-terminus of PTH1R and the SmBiT subunit was fused to the N-terminus of β-arrestin ...
-
bioRxiv - Developmental Biology 2023Quote: ... HEK293 culture medium was replaced by imaging medium containing either Janelia Fluor 646 (JF646) ligand (10 nM; Promega, #GA1120) or OregonGreen ligand (50 nM ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK-293 cells were transfected with FLAG-tagged receptor (3.5 μg) and luciferase-based 22F cAMP biosensor construct (3.5 μg) (Promega). 14–16 h post transfection ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: To measure ATP bound to detergent purified P2X1 receptor a Kinase-Glo® Luminescent Kinase Assay (ProMega, USA) was used ...