Labshake search
Citations for Promega :
51 - 100 of 3140 citations for Laemmli Sample Buffer 2X Solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Frozen brain tissue was homogenised in a dounce-homogeniser containing 2 ml ice-cold lysis solution (Nuclei EZ Lysis Buffer [Sigma-Aldrich, NUC101] or Nuclei PURE Lysis buffer [Sigma-Aldrich, NUC201] with 1 mM dithiothreitol [DTT, Promega, P1171 ...
-
bioRxiv - Cell Biology 2024Quote: ... 20X stock solutions of the respective tracers were prepared in tracer dilution buffer (Promega, #N291B) and 20% DMSO for a final assay plate concentration of 62.5 nM (SYK(S550Y)-NL ...
-
bioRxiv - Cell Biology 2021Quote: ... sample were digested with 100μl of a 5ng/ul sequencing grade modified trypsin solution (PROMEGA). 50μl of Trypsin-generated peptides were vacuum dried ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR solution for each sample contained 12.5 µL GoTaq Green Master Mix (Promega, M7123), 1.5 µL common forward primer ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein samples eluted with biotin were digested in-solution with 1 ug Trypsin/LysC (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Lysate samples are generated by treatment of 1x Passive Lysis Buffer (Promega E1941) to 12 well plate cultures ...
-
bioRxiv - Genetics 2022Quote: ... using a 2x GoTaq G2 Green premix (Promega). 5 μl of the PCR products were used for restriction fragment length polymorphism assay with the appropriate enzymes ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μL 2X Go TaqqPCR Master Mix (Promega), and 300 nM forward and reverse primer ...
-
bioRxiv - Pathology 2020Quote: ... GoTaq® Hot Start Master Mixes 2x (Promega), specific primers (5’ CGCATATGATGGAGCACGTGCA 3’ and 5’ CGGGATCCCTACAGTTTGGCG ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 μl of 2X NanoGlo Lytic reagent (Promega) was added to the wells ...
-
bioRxiv - Molecular Biology 2023Quote: ... The semisoft pellet of worms was weighed to ensure an equal number of worms in each sample (100 µg of worm pellet per sample) and mixed with 800 µL of 1× passive lysis buffer (Promega, #E1910). This was followed by eight cycles of sonication with 3 s on and 30 s off at an amplitude of 40% ...
-
bioRxiv - Microbiology 2021Quote: ... in the digestion solution and lysis buffer of a Wizard SV 96 Genomic DNA kit (Promega). The samples were centrifuged for 10 min at 16,000 g and the supernatant was transferred to the binding plate ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Plant Biology 2023Quote: ... Samples were digested in fresh digestion buffer containing 1 μg Typsin/LysC mix (Promega) and 0.01% ProteaseMAX (Promega ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the medium was removed and the samples were lysed in Passive Lysis buffer (Promega) for 40 min in the case of HEK293T cells and 1 h in the case of the other cell lines used ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized samples for 10 seconds in Maxwell RSC Homogenization Buffer (Promega, Madison, USA) with 2% 1-thioglycerol using a Bio-Gen PRO200 homogenizer (PRO Scientific ...
-
bioRxiv - Genetics 2020Quote: Promega G2 green Taq 2x master mix (Promega, USA) = 5 µL for each reaction ...
-
bioRxiv - Genetics 2022Quote: ... 10 μl 2x GoTaq® Master Mixes (Promega, M7123), and 6 μl water ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... then 10 μL of 2X furimazine (Promega 50X stock) solution diluted in phenol-free high glucose DMEM with GlutaMax was added to each well.
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were performed using Master Mix (2X) (Promega) and carried out at an initial denaturation step of 95 °C for 2 min ...
-
bioRxiv - Bioengineering 2023Quote: ... 12.5 μL of GoTaq Green Master Mix 2x (Promega), and 5.5 μL of Ultrapure DNase/RNASE-Free Distilled Water (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µL 2X master mixture (Promega, Madison, WI, USA), 1 µL forward and reverse primers (for each ...
-
bioRxiv - Plant Biology 2023Quote: ... the 2x GoTaq qPCR Master Mix (Promega, Mannheim, Germany) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... either GoTaq G2 Green Master Mix (2X, Promega, USA) or DreamTaq Green PCR Master Mix (2X ...
-
bioRxiv - Biophysics 2022Quote: ... spheroplast/sucrose buffer suspension was added to 500 μL warm (42 °C) agarose solution (low melting point agarose, V2831 Promega, 2% w/v in sucrose buffer) using a cut pipette tip ...
-
bioRxiv - Cell Biology 2020Quote: ... Then samples were diluted 3 times in the buffer and 1 µg trypsin (Gold. Promega) was added overnight at 30°C ...
-
bioRxiv - Immunology 2021Quote: Cells in BALF samples were pelleted and resuspended in 100 μL RBC lysis buffer (Promega) for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... A volume of 2 µL of the samples was diluted in Glo lysis buffer (Promega) and incubated in a 1:1 ratio for 3 min in the dark with NanoGlo substrate ...
-
bioRxiv - Microbiology 2024Quote: Cells in BALF samples were pelleted and resuspended in 100 μL RBC lysis buffer (Promega) for 1 min ...
-
bioRxiv - Plant Biology 2021Quote: ... We added 300μl of Proteinase K Buffer 2X (200 mM Tris-HCl pH7.5; 100 mM NaCl; 20 mM EDTA; RNasin PROMEGA 20 U/μl; 0.04 mg/ml Proteinase K) and incubated for 1 h at 55 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... Samples were ground to fine powder using pestles on dry ice and then 100 μl 2x cell culture lysis buffer was added (Promega, E1531; with 150 mM Tris-Hcl pH7.5). 50 μl of leaf extract was mixed with 50 μl luciferase substrate (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 μl of 50 mM ammonium bicarbonate buffer as well as 10 μl of protease solution (Promega Trypsin/Lys-C Mix ...
-
bioRxiv - Genomics 2022Quote: ... was resuspended in 1.5 mL salt-tris solution buffer supplemented with 0.2 U/ul RNasin Plus RNase Inhibitor (Promega). The tissue material was spin down at 500 x g for 5 min at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Colony PCR was performed using PCR 2x Master Mix (Promega) with primers listed in Table 3.
-
bioRxiv - Microbiology 2021Quote: ... Colony PCR was performed using PCR 2x Master Mix (Promega) with primers listed in Table S3.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Go Taq® Green Master Mix 2X (Promega Corp., India), genomic DNA template (20 to 30 ng ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 μL 2x GoTaq®qPCR Master Mix (Promega #TM318), and 300 nM forward and reverse primer ...
-
bioRxiv - Systems Biology 2024Quote: ... Following 2X cleanup with ProNex Size-Selective Beads (Promega, NG2001), sequencing was performed on Miseq with PE70 read structure ...
-
bioRxiv - Cell Biology 2024Quote: PCR reaction (Promega Gotaq G2 Master mix 2X (Promega, M7822) 25uL ...
-
bioRxiv - Cell Biology 2024Quote: PCR reaction (Promega Gotaq G2 Master mix 2X (Promega, M7822) 25uL ...
-
bioRxiv - Neuroscience 2022Quote: ... The sample solutions were diluted to 1 M urea with 50 mM ammonium hydrogen carbonate and trypsin (Promega) was added at an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Immunology 2021Quote: ... Then the samples were diluted with 340μL of 100mM ABC and 220μL were added to trypsin solution (Promega) for protein digestion at a trypsin/protein ratio of 1/40 and incubated at 37°C overnight (17h) ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Molecular Biology 2023Quote: ... The complexes were washed with RIPA buffer and the samples were treated with DNAse I (Promega) for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... The chromatin was then incubated for 30 min at 37° C in 50 µl DNase I solution (1X DNase I buffer containing 0.2 U/µl DNase I [Cat #M6101, Promega] and 0.25 U/µl Protector RNase Inhibitor) ...
-
bioRxiv - Cell Biology 2024Quote: ... Tracer 8 (20X) was prepared from a 400 μM stock solution in DMSO with tracer dilution buffer (Promega, #N291B) and 20% DMSO ...
-
bioRxiv - Cell Biology 2024Quote: Column-bound proteins were washed in Binding buffer and then digested with 5 µg of 0.8 µg/µL trypsin solution (Promega) diluted in Digestion buffer (50 mM TEAB at pH 8.5) ...
-
bioRxiv - Genetics 2021Quote: ... 1 μL of cDNA was mixed with Red Taq 2x (Promega), and 0,25 μM of universal reverse primer (complementary to the stem loop one ...
-
bioRxiv - Genomics 2021Quote: ... 1 μL DNA and 5 μL of Master Mix 2x (Promega) (0.3 units of Taq Polymerase ...
-
bioRxiv - Neuroscience 2020Quote: ... with GoTaq qPCR master mix 2X with SYBR Green (Promega, A600A) according to the manufacturer’s protocol ...