Labshake search
Citations for Promega :
51 - 100 of 5993 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Using the dual-luciferase detection kit (Promega #E1910), cells were lysed in the lysis buffer for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 15 μl of Kinase detection reagent (Promega kit) was added to the wells ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Systems Biology 2020Quote: ... luminescence measurements were performed using a GloMax Multi Detection System plate reader (Promega). The average luminescence was subtracted from the average luminescence of respective blank to correct for background ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the plates were subjected to Nano-Glo HiBiT Lytic detection system (Promega, #N3040) as described in manufacturer’s manual ...
-
bioRxiv - Microbiology 2022Quote: ... Luciferase induction in STING-37 cells was determined using the Bright-Glo reagent (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with 9 µg of pMX-STING-GFP using Fugene HD (Promega). Retroviral supernatant was collected 72 hours post transfection ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL/well of One-Glo detection reagent (Promega, cat # E6120) was added to all microplate wells via Multidrop ...
-
bioRxiv - Biochemistry 2023Quote: The initial HaloTag-based APMS (HaloMS) was performed using a commercially available HaloTag ligand plate (Promega, HaloLink 96 Well Plate ...
-
bioRxiv - Neuroscience 2020Quote: The toxicity of PX was investigated on monolayers of BLEC seeded on 96 well plates or on inserts luminal side in co-culture experiments using the commercially available Cytotoxicity Detection Kit (Promega, United States). An aliquot of 25 μl medium was taken to quantify the lactate dehydrogenase (LDH ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Biophysics 2020Quote: ... Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) assay kit (Promega) by determining Formazan absorbance at 590 nm on a Tecan Safire automated plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... and plates were incubated for 5 days before being assayed using the Cell Titer-Glo kit (Promega).
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cell Biology 2020Quote: Cell viability was measured with a tetrazolium-based toxicology assay kit (Promega). CHO cells (1 × 104 cells per well ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Genetics 2019Quote: ... using in situ DeadEnd Fluorometric detection kit (G3250-PROMEGA) according to technical protocol (#TB235) ...
-
bioRxiv - Pathology 2021Quote: ... Fluorescence of the lysates was then analyzed using a multi detection plate reader (Promega Glomax Multi Detection System ...
-
bioRxiv - Cell Biology 2020Quote: Cellular ROS was measured through the detection glutathione in its reduced (GSH) and oxidized (GSSG) forms using the luminescence-based GSH/GSSG-Glo™ Assay (Promega, V6611). Briefly ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 3’UTR-: 5’-TTGCGGCCAGCGGCCGCTCTCCAAACTTGAATCAATAAATTT-3’ and inserted into a dual luciferase psiCHECK2 backbone (Promega). RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech ...
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Plant Biology 2023Quote: ... we used a luciferase-based GTPase assay (GTPase-GloTM Assay Kit by Promega). The assay was carried out as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega) at 450nm absorbance.
-
bioRxiv - Cancer Biology 2023Quote: ... All assays were performed in triplicate in a Glomax multi-detection system plate reader (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Cancer Biology 2023Quote: ... day 5 and day 7 for each condition using the CellTiter-Glo (CTG) luminescence-based assay (Promega). Diluted CTG reagent (100 uL 1:4 CTG reagent to PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 105 HEK293T cells were seeded into 24-well plates and co-transfected with pGL4.10-based plasmids and pRL-SV40 Renilla luciferase plasmid (Promega). After 48 hours ...
-
bioRxiv - Synthetic Biology 2021Quote: Transcription-based luciferase reporter assays were performed with the Dual-Glo kit (Promega; E2920). HEK cells were transfected in a 96-well plate with GPCR or empty vector (95ng) ...
-
bioRxiv - Microbiology 2022Quote: ... using the Promega GoTaq BRYT Green® dye-based qPCR kit (Promega, WI, USA) with 200 nM concentration of the appropriate primers ...
-
bioRxiv - Microbiology 2023Quote: qPCR was performed using the intercalating dye based GoTaq qPCR master mix kit (Promega). Briefly ...