Labshake search
Citations for Promega :
351 - 400 of 5993 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... extracellular and intracellular assays were performed to determine levels of HiBiT-tagged F3 using either the Nano-Glo HiBiT Extracellular Detection System or the Nano-Glo HiBiT Lytic Detection System (Promega). For the extracellular HiBiT protocol ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A total of 24 clones (4 holobionts x 3 replicates x 24 clones = three 96-well plates) from each amplicon were amplified directly with GoTaq polymerase (Promega, Lyon France) in a 25 μL reaction volume using the following PCR parameters ...
-
bioRxiv - Neuroscience 2020Quote: Caspase activity was measured using a chemiluminescent assay kit (Promega Caspase-Glo® 3/7) in 96-well format using an Analyst HT plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activation was measured using the CaspaseGlo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions for the indicated time point presented in the figure legend ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptosis activities were detected using substrate from the Caspase-3 Glo Apoptosis kit (Promega, WI).
-
bioRxiv - Biochemistry 2020Quote: ... on a GloMax-discover multimode detection system (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... the Nano-Glo HiBiT Lytic Detection System (Promega) was used for the quantification of the HiBiT tags ...
-
bioRxiv - Immunology 2020Quote: ... and a GloMax-Multi Detection System (Promega, USA).
-
bioRxiv - Pathology 2020Quote: ... and GloMax-Multi Detection System Photometer (Promega, USA).
-
bioRxiv - Microbiology 2022Quote: ... which was detected with luciferase detection reagent (Promega). Luminescence measurements were done using a LUMIstar OMEGA plate reader (BMG ...
-
bioRxiv - Systems Biology 2023Quote: ... 10 µl of MTase-Glo Detection Solution (Promega) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 10 μl of detection reagent (Promega) to the system ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µL Luciferin Detection Reagent (Promega Cat #TM344) was added to all wells ...
-
bioRxiv - Molecular Biology 2023Quote: ... then 25 μl MTa-Glo Detection Solution (Promega) was added and incubated for a further 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by luminescence detection using GloMax Explorer (Promega). The bioluminescence readings were averaged amongst the n=3 technical replicates for each construct and ratio ...
-
bioRxiv - Cancer Biology 2024Quote: The NanoBRET™ Nano-Glo detection System (Promega) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Physiology 2021Quote: ... Extracts were used for quantification of luciferase as proxy for ATP content using the ENLITEN® ATP Assay System Bioluminescence Detection Kit (Promega) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.5 µg (HEK293A, HEK293T, HEK293AΔARRB1/B2) or 2 µg (HEK293AΔGs, HEKS293AΔGi) Glo-22F cAMP plasmid DNA (Promega) and 2 µg MOCK DNA (HEK293A ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transfected into HeLa cells for 24 h (2 μg of cDNA/9.6 cm2 plate) using Fugene (Promega). For gene silencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were recombined into 80,000 U-2 OS cells in a 24 well plate using 1.5 uL of FuGENE6 (Promega E2691) in 100 uL OPTIMEM (Fisher Scientific 31985070 ...
-
bioRxiv - Genetics 2021Quote: ... Development and stop solutions were added followed by detection of absorbance at 450 on a Luminometer: GloMax-Multi Detection System (Promega, USA).
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR-based genotyping (GoTaq Green MasterMix, Promega, and C1000 Touch Cycler, Bio-rad) was used to detect the genes ...
-
Mutant ACTB mRNA 3′UTR Promotes Hepatocellular Carcinoma Development by Regulating miR-1 and miR-29abioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into the pGL3-promoter luciferase-based plasmid (Promega) at the cloning site between KpnI and XhoI ...
-
bioRxiv - Microbiology 2020Quote: ... These fusions were expressed from plasmids based on the pGEM-T backbone (Promega) named pOP plasmids (22) ...
-
bioRxiv - Cancer Biology 2020Quote: ... a luminescent ATP-based assay was performed using the CellTiterGlo reagent (Promega G7572) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... based on a mutated RIIB cAMP-binding domain from PKA (pGloSensor-20F, Promega), which produces rapid and reversible cAMP-dependent activation of luciferase activity in intact cells and is capable of detecting cAMP elevations in the absence of phosphodiesterase inhibitors ...
-
bioRxiv - Plant Biology 2023Quote: ... we used in vitro translation system based on Wheat Germ Extract (Promega Corporation), which has been used for SCR validation as reported previously31 ...