Labshake search
Citations for Promega :
901 - 950 of 961 citations for Octreotide acetate impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega Cat. No. V5111). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and incubated overnight at 25 °C or endoproteinase GluC in a GluC/protein ratio of 1/20 (w/w) (Promega Cat. No.V1651) and incubated overnight at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: Protein samples were alkylated with 10 mM iodoacetamide in the dark at 37°C for 30m and subsequently digested with trypsin (Promega, 50 ng) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized with primers specific for each strand separately at 50 °C (Supplemental Table S1) using the ImProm-II™ Reverse Transcription System (Promega, A3800) and subjected to qPCR with primers specific for the viral N-protein (Supplemental Table S1).
-
bioRxiv - Physiology 2022Quote: ... protein samples were digested by incubated overnight at 37°C with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin). Samples were acidified using 5% TFA and peptides cleaned up using the Phoenix 96× kit (PreOmics ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Zoology 2022Quote: ... The mixture was diluted with 150 μL of 50 mM Tris-HCl pH8.0 and digested by adding 500 ng Trypsin/Lys-C mix (Promega, Madison, WI, USA) overnight at 37 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... 102.2 µL of 100 mM TEAB was added and proteins were digested for 16 hours at 37°C using 5 µg of trypsin (dissolved in trypsin resuspension buffer, Promega, Walldorf, Germany). Tryptic digestion was stopped by addition of 2.5 µL 100% formic acid ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was extracted at the NCPHL from subcultures inoculated with single bacterial colonies and grown in nutrient agar (Oxoid, USA) at 37°C overnight according to the manufacturer instructions (Wizard® Genomic DNA Purification kit, Promega, UK). Genomic DNA samples (derived from 10 environmental and 250 clinical samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Microbiology 2024Quote: ... culture supernatants were frozen at −s80°C and macrophages were processed according to the Promega E1500 Luciferase Assay System protocol (Promega, Madison, WI). Cells were lysed and incubated with D-Luciferin substrate for 5 min in white Lumitrac™ plates (Greiner Bio-one ...
-
bioRxiv - Biochemistry 2023Quote: One-hundred microliters of 50 mM Tris-HCl (pH 8.0) and 500 ng of trypsin/Lys-C mix (Promega, cat. no. V5072) were added to the washed HaloTag ligand plate following the first-generation assay and mixed gently at 37 °C overnight to digest the proteins ...
-
bioRxiv - Plant Biology 2022Quote: ... and alkylation treatment (100 mM iodoacetamide / 45 min incubation at room temperature) were followed by 16 hr incubation at 37°C with sequencing grade trypsin (Promega, Madison WI). Tryptic peptides were acidified with formic acid ...
-
bioRxiv - Systems Biology 2023Quote: ... and the bound proteins were subjected to on-cartridge digestion with mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega, Madison, WI) at 70°C for 2h ...
-
bioRxiv - Plant Biology 2024Quote: ... The Halo-DREB2D fusion protein was obtained by coupled in vitro transcription/translation for 2 h at 27 °C using the TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega, WI, USA). Halo-DREB2D synthesis was verified by Western blot using Anti-HaloTag® Monoclonal Antibodies (Promega) ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested with Lys-C (Wako, Japan) at a 1:100 enzyme-to-protein ratio at room temperature overnight and then with trypsin (Promega, Madison, WI) for at least 4 hours at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Buffer was then exchanged washing the membrane three times with 50 mM NH4HCO3 and proteins digested overnight at 37°C using trypsin (Trypsin Gold, Promega, Madison, WI) at an enzyme-to-protein ratio of 1:50 (w/w).
-
bioRxiv - Cancer Biology 2024Quote: ... tissues were incubated with primary antibodies diluted in 10% DS in PB1 for 3 days at 4°C followed by four washes over the following day with 0.2% Tween-20 (Promega UK Ltd, H5151) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... five µg protein were reduced by 2.5 mM dithiothreitol for 30 min at 37°C and alkylated with 10 mM iodoacetic acid for 30 min at 37°C in the dark before digestion by trypsin (Promega, Walldorf, Germany) in a protein to enzyme ratio 25:1 overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified by centrifugation (500 x g, 5 min, at 15°C) and mixed 1:1 with 2× passive lysis buffer (Promega cat #E1941). Cell monolayers were washed in PBS and lysed in 1× passive lysis buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... then both soluble and insoluble protein lysates were reduced with 5 mM dithiothreitol and further alkylated with 15 mM iodoacetamide and processed for overnight digestion at 37°C in S-Trap columns (Protifi) using a Sequencing Grade Modified Trypsin (Promega, Catalog # V5111). The peptide mixtures were eluted from the columns ...
-
bioRxiv - Microbiology 2020Quote: ... plates were incubated at 37°C for 72 hours prior to assessing luciferase activity using the Renilla-Glo Luciferase Assay System (Promega, Madison, WI, USA). Readout of eGFP was done by incubating and monitoring plates at 37°C for 72h in an IncuCyte® (Essen BioScience Inc. ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was prepared from a single colony cultured overnight at 37°C in LB using the Maxwell 16 system (Promega Corp., Madison, WI). Libraries for Illumina sequencing were prepared using either Nextera XT (Illumina ...
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Microbiology 2020Quote: ... for 20 min at 56°C before DNA was purified with Maxwell® RSC Blood DNA Kit (Promega Pte. Ltd., Cat. No. AS1400). DNA concentration was quantified using Qubit® 2.0 fluorometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate obtained from each tumour sample was mixed at 1:1 ratio with the super-SILAC standard prior to FASP digestion41 with Endoproteinase Lys-C (Alpha Laboratories, UK) and trypsin (Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... and the RNA was precipitated with an equivalent volume of isopropanol and incubated at 55°C for 10 minutes before being resuspended in 50 μL of RNase-free water (Promega, Madison, WI, USA). We determined the concentrations of RNA using a Smart-Spec plus spectrophotometer (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... collected by centrifugation (17,000 g for 10 min at 4°C) and solubilized in 20 μl 50 mM TEAB containing 0.2 % ProteaseMAXTM Surfactant (Promega UK Ltd, Cat. # V2071) for 1-2 h with vortex and occasional sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transfected cells were cultured at 37°C for 36 h and subjected to luciferase activity analysis using the Dual-Glo Luciferase Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcribed and translated FLAG-tagged ERRα protein was made using the TnT reticulocyte reaction (Promega cat #L1170, 2h on 37°C) or the TnT wheat germ extract (cat #L5030 ...
-
bioRxiv - Cell Biology 2023Quote: Affinity purified proteins retained on beads were resuspended in 100 µL of NH4HCO3 at 25 mM containing 2 µg of Trypsin/Lys-C mix (Mass Spec Grade, Promega, Madison, WI, USA). Digestion was performed under agitation at 37°C during 4h ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Plant Biology 2024Quote: ... 25 µg of phloem sap and 50 µg of leaf tissue protein extract were then digested in solution using a Trypsin/Lys-C mixture (Mass Spec Grade, Promega, Madison, WI, USA) according to the instruction manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... Seventy micrograms of protein were digested overnight using the filter-aided sample preparation (FASP) method 23 with Trypsin/Lys-C mix (Promega, Madison, WI, USA) (enzyme-to-protein ratio 1:35 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was added and samples were digested for two hours at 37°C followed by addition of 1 μg of sequencing-grade Trypsin (Promega, Ref. No. V5113) and digestion overnight at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in 200 μL of 0.02 μm filtered ultrapure water and treated with DNase (briefly, incubation at 37°C for 30 min after adding 10 units of RQ1 RNase-free DNase, Promega, Madison, WI, USA). We then extracted DNA using the DNeasy PowerSoil Pro kit (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... BP1425-500) at 37 °C and the plasmid was isolated from single colonies using the PureYield Plasmid Midiprep kit (Promega, Cat no. A2495), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Biophysics 2024Quote: ... BRET spectral scan measurements were performed at 37 °C using a Tecan SPARK® multimode microplate reader after the addition of furimazine (Promega, Wisconsin, USA) at a dilution of 1:200 as previously described.38,104,105
-
bioRxiv - Biochemistry 2024Quote: ... In-solution digestion was performed overnight in a ThermoMixer at 2000 rpm at 37 °C with a protein-to enzyme ratio of 1 to 100 for both LysC (Wako, Osaka, Japan) and Trypsin (Promega, Madison, WI, USA). Tryptic peptides were acidified with 1% trifluoroacetic acid (TFA) ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 10-fold with 50 mM triethylammonium bicarbonate buffer at pH 8 and incubated overnight at 37°C with sequencing grade trypsin (Promega, San Luis Obispo, CA) at a 1:50 enzyme:substrate ratio (wt/wt) ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by a second dilution step to ~1 M urea with 50 mM NH4HCO3 and addition of trypsin (Promega, 1:50, 37 °C, overnight). After overnight incubation ...
-
bioRxiv - Immunology 2022Quote: ... and digested over-night with Lys-C-Trypsin mix (1:100 enzyme to protein ratio) and trypsin (Promega; 1:50 enzyme to protein ratio). Following the digestion step ...