Labshake search
Citations for Promega :
901 - 950 of 3874 citations for Mouse Chitinase 1 CHIT1 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) and trypsin (Trypsin Gold, Promega).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were digested with trypsin (Sequencing Grade Modified Trypsin, Promega, Madison, WI, USA) at a 1:50 (trypsin:protein ...
-
bioRxiv - Plant Biology 2021Quote: ... The protein expression reaction was mixed with HaloTag-ligand conjugated magnetic beads (Promega) to pull down the HaloTag-fused TF ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... The proteins enriched by neutravidin beads were digested with MS-grade trypsin (Promega). The on-beads digested peptides were collected and desalted by the in-house prepared reversed phase C18 Stage-tip ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were subjected to digestion using 20 µg sequencing grade Glu-C (Promega) in 1 M urea at 37°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... HiBiT-fused proteins were visualized using the Nano-Glo HiBiT Blotting System (Promega). As an internal control of HiBiT proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... the bead-bound protein was incubated with 6.7 μM HaloTag-TMR ligand (Promega) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and IgG captured and eluted from Magne Protein A beads (Promega, Madison, WI) as previously described (27 ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequent protein digestion was performed using Endoproteinase LysC and Trypsin (Ref.: V5071, Promega), diluted 1:25 (enzyme to protein ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were digested using a trypsin and lys-C mix (Promega, Madison, USA) at a ratio of 100:1 ...
-
bioRxiv - Systems Biology 2023Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Biophysics 2023Quote: Labeling reactions: Proteins with HaloTag were labeled with JF646-HaloTag ligand (Promega # GA1120) by incubating the proteins with a tenfold excess of dye on ice for 0.5-1 h in the presence of 1 mM ATP ...
-
bioRxiv - Systems Biology 2023Quote: ... The washed protein was then digested with trypsin (sequencing grade modified trypsin; Promega) in a mixture of 100 mM ammonium bicarbonate (pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro protein synthesis by the coupled transcription and translation (TnT) system (Promega) was carried out in the presence of 35S methionine in either wheat germ or rabbit reticulocyte lysates ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Cell Biology 2022Quote: The protein in the gel lanes were digested with 0.1 µg trypsin (Promega) in 20 µl 25 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested with 0.75 µg trypsin (Sequencing Grade Modified Trypsin, V5111, Promega) overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Cleared protein extracts were incubated with 200 μl of MagneHis solution (Promega, USA) overnight ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were then in-gel proteolyzed using Sequencing grade modified porcine trypsin (Promega), and peptides were eluted (80% acetonitrile ...
-
Mitochondrial dysfunction rapidly modulates the abundance and thermal stability of cellular proteinsbioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 μg of sequencing grade modified trypsin (Promega, #V5111) in 40 μl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Cell Biology 2022Quote: Proteins were digested from gels with 0.02 μg/μL modified porcine trypsin (Promega) after reduction with dithioerythritol and iodoacetamide ...
-
bioRxiv - Biophysics 2022Quote: ... Cleaved MSP protein was subsequently biotinylated using EZ-Link Maleimide-PEG11-Biotin (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... An equal number of proteins were digested with trypsin (Promega, Madison, WI, USA) at a ratio of 1:50 (w:w ...
-
bioRxiv - Neuroscience 2022Quote: ... the proteins were digested with 1.5 µg of Trypsin/Lys-C mix (Promega) for 16 h at 37°C (800 rpm) ...
-
bioRxiv - Biochemistry 2023Quote: ... RBD proteins in culture media were measured in Nano-Glo buffer (Promega N1110) supplemented with Nanoluciferase substrate and 11S protein according to the manual ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were then digested overnight at 37°C with Trypsin Gold (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2023Quote: ... and digestion of purified crosslinked protein with sequencing grade modified porcine trypsin (Promega), tryptic peptides were separated by reverse phase XSelect CSH C18 2.5 um resin (Waters ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were digested with Lys-C (Wako) and sequencing-grade trypsin (Promega, V5117) (1 μg of each in 20 μL of 50 mM TEAB ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested with 0.8 µg/µL trypsin solution (proteomics grade trypsin, Promega). Peptides were then eluted in 65 µl Digestion buffer (50 mM TEAB pH 8.5) ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested using 0.005 µg/µl trypsin (sequencing grade modified trypsin; Promega) in 40 mM NH4HCO3/10% ACN at 4°C for 20 minutes followed by 16 h at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... In-solution on-bead digestion of proteins was performed using Immobilized trypsin (Promega, sample-enzyme solution ratio of 94 (v/v) ...
-
bioRxiv - Plant Biology 2024Quote: ... HALO-TF protein was subsequently incubated with 10 ug of MagneHALO beads (Promega) for 1 hour rotating at room temperature ...
-
bioRxiv - Plant Biology 2024Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fusion proteins were directly purified using Magne Halo Tag Beads (Promega, USA). HaloTag–transcription factor fusion proteins were incubated with an adaptor-ligated genomic DNA library ...
-
bioRxiv - Plant Biology 2024Quote: ... The proteins were proteolytically digested on the column by incubation with trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were expressed using TnT® Quick Coupled Transcription/Translation System (Promega L1170), according to manufacturer’s instructions and stored at -80°C.
-
bioRxiv - Immunology 2024Quote: ... and IgG captured and eluted from Magne Protein A beads (Promega, Madison, WI) as previously described 18,19 ...
-
bioRxiv - Plant Biology 2024Quote: ... The HALO-fused CBF proteins were purified thanks to Magne HaloTag beads (Promega). A control sample corresponding to HaloTag protein alone was used (referred to as pIX-HALO empty) ...
-
bioRxiv - Neuroscience 2024Quote: GDNF protein levels were measured with the GDNF Emax Immunoassay System (G7620, Promega), according to the protocol provided by the manufacturer ...
-
bioRxiv - Biophysics 2024Quote: Proteins were translated in-vitro using the TnT Coupled Reticulocyte Lysate System (Promega). Constructs in a pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The protein was purified under native conditions using MagneGST Glutathione Particles (Promega, #V861A). After annealing two complementary oligonucleotides (5’-AAAATACGAGGTCAGTCGTCACCTTTGCTTGCCCAGTTGTTTACTTCGTTTAAA -3’ and 5’-AAATTTAAACGAAGTAAACAACTGGGCAAGCAAAGGTGACGACTGACCTCGTAT -3’ for the Meox upstream region ...
-
bioRxiv - Microbiology 2020Quote: ... As secondary antibody an anti-mouse IgG HRP conjugate (Promega, Madison, WI, USA) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the full-length mouse HCN2 was cloned in pCI (Promega) mammalian expression vector ...
-
bioRxiv - Cell Biology 2021Quote: ... and then anti-mouse IgG (H&L) alkaline phosphatase-conjugated secondary antibodies (Promega) were incubated with the blots at a dilution of 1:5,000 for 1 h at room temperature (RT) ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used for immuohistochemistry: mouse anti-β-gal (Z3781, Promega), chicken anti-NeuN (266006 ...