Labshake search
Citations for Promega :
901 - 950 of 1081 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM MgCl2, 1.5 mM KCl, 100 μ g/ml cycloheximide, 1mM DTT, 200 U/ml RNase in from Promega, 0.5% Sodiumdeoxycholate ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... To quantify the activity of reports groups of 5 embryos were collected 8 hours post-injection in triplicates and lysed in 100 mL of lysis buffer (Promega). Reporter expression was quantified with the Nano-Glo Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were then incubated for 72 h at 37°C and 5% CO2 and cell viability determined by CellTiter-Glo Luminescent Cell Viability Assay (Promega). In short ...
-
bioRxiv - Cell Biology 2024Quote: ... An amount corresponding to 5 % of the pull-down volume was saved for Western blot analyses and 1 µg of trypsin gold (Promega) was then added to the beads for 16 h at room temperature in a thermomixer at 600 RPM ...
-
bioRxiv - Cell Biology 2024Quote: 2-3 days before the recording the cultures were transferred into a recording medium containing 5% FBS and 0.1 mM luciferin (Promega E1601) (Feeney et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNAs were amplified with 6 PCR cycles using short Solexa P3/5 primers to allow beads-based size selection with ProNex Beads Size-selection Chemistry (Promega). In order to avoid over-amplification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each well was transfected with 500 ng pGL4.22 vector with or without H1-0 promoter expression as well as 5 ng Renilla luciferase control plasmid pGL4.73 (Promega, #E6911), and 250 ng of the respective pcDNA3.1 vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Biochemistry 2024Quote: ... then resuspended in 1 gel volume of 25 mM ABC containing 5 ng/µL of digestion grade trypsin (Promega, V5111) and incubated at 37°C for 16 hours for a full digestion or for 15 minutes for a partial digestion ...