Labshake search
Citations for Promega :
751 - 800 of 1081 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription reactions were performed by adding 0.5 µl (corresponding to 5 U) of AMV Reverse Transcriptase (Promega), 0.1 µl dNTP mix (10 mM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... lactate assay was performed using 5 µl of media and the luminometric Lactate-Glo assay kit (Promega, #J5021) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was diluted either 1:5 or 1:10 for all qPCR experiments and GoTaq qPCR Master Mix (Promega) was used to amplify cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then diluted to 2 M urea final concentration via the addition of 20 mM HEPES pH 8.0 and digested overnight with 5 µg/ml sequence-modified trypsin (Promega) at room temperature.
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Molecular Biology 2021Quote: ... before cells were permeabilized using 0.2% Triton X-100 PBS for 10 min at room temperature, then blocked for 30 min (2% BSA / 0.5% fish skin gelatine / PBST.5, 2U/µL RNAsin Plus (Promega) at room temperature) ...
-
bioRxiv - Immunology 2019Quote: ... and the pellet was resuspended in 20 mL buffer A (NaPO4 20 mM, NaCl 500 mM and imidazole 20 mM, pH 7,4) containing 5 U of DNAse (Promega) and 30 ug/mL lysozyme (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of forward and reverse primer (5 μM, see Supplementary Table 1) and 5.5 μL of Nuclease-free Water (Promega). The PCR I was performed as follows ...
-
bioRxiv - Immunology 2021Quote: ... for 48h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μL of DNA or 5 μL of cell lysate were mixed with 12.5 μL of GoTaq Colorless Master Mix (Promega), 1 μL of forward and reverse primer (5 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 5 min quenching with 100 mM glycine and permeabilization with 0.5% Triton X-100 (Promega, Madison, WI) in 1 × PBS for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were brought to room temperature for 5-10 minutes while 2 mL of 30 mM coelenterazine (Promega), or 15 mL of 1-to-50 diluted NanoLuc substrate (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... Urea was reduced to 1 M by addition of 500 ml AB and overnight digestion was performed at 37°C with 5 ml of freshly prepared 0.2 mg/ml trypsin (Promega) in AB ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was reduced with 5 mM DTT and alkylated with 14 mM iodoacetamide followed by digestion with trypsin (1:100, w:w) (Promega) as described in [80] ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were incubated for 72hr at 37°C with 5% CO2 and then measured by CellTiter-Glo assay (Promega). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... The reaction was incubated at 30 °C for 5 hours and 2.5 µL of the reaction mix was added to 50 µL of luciferase assay reagent (Promega) pre-equilibrated in room temperature ...
-
bioRxiv - Cell Biology 2021Quote: cDNA synthesis was performed using 1-5 μg of total RNA with random hexamers and reverse transcriptase (Promega, GoScript). Quantitative RT-QPCR was performed in triplicate for each samples using the KAPA SYBR PCR kit (Sigma Aldrich KK4600 ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were then diluted with water (1:5) and incubated overnight at 37°C with 0.5 µg of sequencing grade modified trypsin (Promega). Samples were acidified using 1% TFA and peptides separated into 3 fractions on a 200 µL StageTips packed with three Empore™ SPE Disks SDB-RPS (3M ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... a second jar of xylene for 5 min then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Liquid was removed and gel pieces were dehydrated in 100% ACN at RT for 5 min at 2,000 rpm followed by rehydration in 100 mM NH4HCO3 containing 14 ng/μL trypsin (Promega) on ice for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega, WI, USA). Purified PCR fragments and pGEM cloning 5’-terminal sequence of BToV were sequenced using primers designed for every ∼300 bp of the BToV genome ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of template DNA was added to 5 μl Green GoTaq Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 1.25 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Pathology 2022Quote: ... G490 5 × All-In-One RT MasterMix (abm) was used for reverse transcription according to the manufacturer’s protocol (Promega). The qRT-PCR analysis was performed in 96-well plates using the BIO-RAD CFX96 detection system ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Immunology 2022Quote: ... Transduced cells were incubated for 24 hours at 37°C/5% CO2 and luminescence measured by addition of 40μl of ONE-Glo reagent (Promega) with detection using a Tecan Spark plate reader ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplifications were carried out in a total reaction volume of 10μL containing 5 μL of 2xGoTaq master mix (Promega) and 2.5 μL of 4M betaine ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Biochemistry 2019Quote: ... All samples were further diluted with 20 mM HEPES pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 μg trypsin (V5111, Promega) (1/100 ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs], 0.5 µl RNasin [N2615, Promega GmbH] ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Neuroscience 2024Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).