Labshake search
Citations for Promega :
901 - 950 of 2104 citations for 6 AMINO 3 HYDROXY PYRIDO 2 3 B PYRAZINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using chymotrypsin (Mass Spectrometry Grade, Promega) or alpha lytic protease (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Microbiology 2022Quote: ... at 72° C for 10 min to add 3’-A overhangs for T/A cloning with pGEM-T Easy plasmid (Promega). A 610 bp DNA fragment upstream of flgV was amplified using PCR primers 85 and 86 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using trypsin (Mass Spectrometry grade, Promega), chymotrypsin (Mass Spectrometry Grade ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... the cDNA fragments corresponding to the coding region or 3′-UTR of mouse Inka2 cDNA were subcloned into a pGEM-3Z plasmid vector (Promega) for in vitro transcription ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Molecular Biology 2023Quote: ... All transfections were done in triplicate and luciferase activity measured after 3 days using the Dual Luciferase Reporter Assay System (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Biochemistry 2023Quote: ... using 3 µl of the in vitro translation reaction mixture in 150 µl of luciferase assay reagent (Promega, Fitchburg, WI). The graphs in Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Microbiology 2020Quote: ... HeLa cells were transfected 6 hours before imaging with Fugene 6 (Promega) and 1000ng of DNA ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Genetics 2019Quote: ... total RNA was treated with 2 U of RQ1 RNase-Free DNase (Promega, USA) at 37°C for 30 min ...
-
bioRxiv - Genomics 2021Quote: - A combination of KAPA HotStart ReadyMix and Pfu DNA Polymerase (2 U/μL, Promega) was used in some tests to try to increase enzyme processivity ...
-
bioRxiv - Microbiology 2021Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega). CSV files were exported onto a USB flash drive for analysis.
-
bioRxiv - Systems Biology 2020Quote: ... The transfections were performed with 1 μg DNA: 2 μl Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Physiology 2021Quote: ... and simultaneously transfected with 2 μg of DNA using Fugene HD (catalog #E2312, Promega), accordingly to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... diluted 1:2 with PBS and read on a GloMax Multi+ Detection System (Promega).
-
bioRxiv - Microbiology 2022Quote: ... 2 cm strips of intestinal tissues were embedded in low melting point agarose (Promega) to enrich for well-oriented crypt-villus units ...
-
bioRxiv - Plant Biology 2021Quote: ... http://cshprotocols.cshlp.org/content/2009/2/pdb.prot5110.abstract) with trypsin (porcine, side chain protected; Promega). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... and the pre-cleared lysate was supplemented with 2 µl of RNasin Plus (Promega), added onto the freshly prepared ...
-
bioRxiv - Biophysics 2020Quote: ... containing 10% (vol/vol) FBS and 2% (vol/vol) GloSensor cAMP stock solution (Promega). The cells were then incubated for 2 hours at room temperature in the dark ...