Labshake search
Citations for Promega :
701 - 750 of 2104 citations for 6 AMINO 3 HYDROXY PYRIDO 2 3 B PYRAZINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM CaCl2 with 2 ug trypsin (Promega, Madison, WI, product V5111). Digest was stopped with formic acid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the luminescence was measured on a luminometer (Mithras LB 940 Berthold Technologies plate reader ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Genomics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated with 2% of the GloSensor reagent (Promega, cat. # E1290). Relative luminescence units were recorded using a SynergyMx microplate reader (Biotek) ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 50 ng/well of the psiCHECK-2 (Promega) construct using the FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). The PCR amplicons were applied onto a 2% agarose gel with appropriate controls and markers.
-
bioRxiv - Microbiology 2022Quote: ... On-bead digestion was performed using sequencing-grade trypsin (2 μg; Promega) in 2 M urea in 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were shortly cooled to room temperature and 2 µl LysC (Promega) added pre-diluted in ultra-pure water to 2 ng/µl and digested for 4 h at 37°C in the thermal cycler ...
-
bioRxiv - Neuroscience 2023Quote: ... before introduction of 2 μl seeds (diluted 1:5) using MultiFectam (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were digested with 2 μg of trypsin (Promega, Madison, WI, USA) at 47°C for 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and digested for 2 hours at 50°C using Trypsin Platinum (Promega) using 1:50 Trypsin to sample ratio by mass ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 1 mM CaCl2 and digested with 2 μg trypsin (Promega) for 15 h at 37ᵒC ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated in 2 nM JF549-Halo-ligand (Cat. No. GA1110; Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...