Labshake search
Citations for Promega :
851 - 900 of 4498 citations for Human Procollagen II C Terminal Propeptide PIICP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of lysate was added to a 1.5 ml Eppendorf tubes containing 100 µl of luciferase assay reagent II (Promega luciferase assay system, Cat# E1500) and the mixture pipetted in and out three times ...
-
bioRxiv - Microbiology 2020Quote: NCIMB8209 DNA was isolated using a commercial kit (Wizard Genomic DNA purification kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... column purification kits or Maxwell 16 LEV simplyRNA Purification Kits (Promega, Madison, WI, USA) and prepared cDNA libraries using TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2022Quote: DNA was extracted with several different kits: the Wizard Genomic DNA Purification kit (Promega), the Qiagen Blood & Tissue kit ...
-
bioRxiv - Cell Biology 2019Quote: Proteins were incubated overnight at 37°C with 20 µl of 25 mM NH4HCO3 containing sequencing-grade trypsin (12.5µg/ml, Promega) at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was digested for 2 h with 0.5 µg of endoproteinase lysine-C (Wako chemicals) and then digested with 0.5 µg of trypsin (Promega) overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were incubated at 37°C for 72 hours and cell viability was measured using Cell TiterGlo (Promega). Percent viability of treated wells was calculated by normalizing to the average Cell TiterGlo values from untreated wells.
-
bioRxiv - Genomics 2020Quote: ... Beads were resuspended in 50μL 100mM AMBIC and incubated overnight at 37°C with 400ng Trypsin (Promega V5280). Beads were supplemented with an additional 400ng Trypsin and incubated for a further 4 hours at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were diluted two-fold again and incubated overnight at 37 °C with trypsin (sequencing grade modified, Promega) at a 1:50 (w/w ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were diluted two-fold with 20 mM HEPES pH 8.0 and proteins digested with Lys-C (Promega) at a protease/protein ratio of 1:100 (w/w ...
-
bioRxiv - Biochemistry 2020Quote: ... Enzymatic digestion of was performed overnight at 37°C by the addition of sequencing grade trypsin (Promega, Wisconsin) (100 ng per sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... the protein extracts were then incubated overnight at 37°C with 20 μl of 25mM NH4HCO3 containing sequencing-grade trypsin (12.5μg/ml, Promega). The resulting peptides were desalted using ZipTip µ-C18 Pipette Tips (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 72°C for 20min and then TA cloned into the pGEM-T Easy vector (Promega, Madison, WI). The cloned PCR products were Sanger Sequenced with M13 Forward (5’-TGTAAAACGACGGCCAGT-3’ ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Microbiology 2020Quote: ... emission 410 nm) was immediately measured every 15 minutes at 37°C using a GloMax plate reader (Promega).
-
bioRxiv - Neuroscience 2020Quote: ... The mixture was then and incubated for 7min at 55°C followed by an additional 7 minute incubation with 3.5µl of SDS 0.2% (Promega, #V6551) to ensure that Tn5 was dissociated from the cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were digested overnight at 37 °C with 6 ng μL-1 of Asp-N (Promega, UK). Peptides were extracted in 2 % v/v formic acid ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins on magnetic beads were digested overnight at 37°C with 1μl (0.2 μg/μL) of trypsin (Promega) in a 25-mM NH4HCO3 buffer per sample ...
-
bioRxiv - Molecular Biology 2019Quote: 1875 ng of circular plasmids were incubated at 37°C with 50 U of T3 RNA Polymerase (Promega) in a transcription buffer (40 mM Tris-HCl pH 7.9 ...
-
bioRxiv - Microbiology 2019Quote: ... were reverse transfected with 50 ng pCAGEN-HA plasmid and 12.5 ng pcDNA3.1+/C-(K)DYK protease-plasmid using Fugene 6 (Promega). After 24 h ...
-
bioRxiv - Cell Biology 2020Quote: ... The proteins were then digested overnight at 37°C with 0.2 μg of modified sequencing grade trypsin (Promega) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were diluted to 1.5 M urea using 20 mM HEPES (pH 8.5) and digested at 30°C overnight with trypsin (Promega) at a ratio of 70:1 (w/w) ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were digested on the column with 0.25 µg of Trypsin/Lys-C protease mix (Promega; cat. V5071), and peptides eluted for mass spectrometry.