Labshake search
Citations for Promega :
801 - 850 of 4498 citations for Human Procollagen II C Terminal Propeptide PIICP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were diluted 4-fold prior to overnight digestion at 37 °C with trypsin (Trypsin Gold, Promega) at an enzyme to substrate ratio of 1:50 ...
-
bioRxiv - Neuroscience 2020Quote: ... Assay was performed at 37 °C and resorufin fluorescence was measured on GloMax Multi Detection System (Promega) plate reader with an excitation wavelength of 530-540 nm and an emission wavelength of 585-595 nm.
-
bioRxiv - Neuroscience 2019Quote: ... for 16 h at 37°C followed by a second digestion step with 0.15 µg trypsin (Promega) for 4 h at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... The samples were further digested overnight at 37 °C with the addition of sequencing grade chymotrypsin (Promega) to a final protease:protein (w:w ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were digested in-gel using trypsin (Gold Promega, 1 μg per band, overnight at 30°C,) as previously described (Thouvenot et al. ...
-
bioRxiv - Microbiology 2022Quote: ... the modified region was amplified using primer SAM_Seq_Gen-23_FW (5’-GAT TTG AGG ACG ACT GGA CTG C) and SAM_Seq_Gen1116_RV (5’-GTC AAC TGA ACA ACC CCA AGG T) together with GoTaq polymerase (Promega), followed by cloning into pGEM T-easy vector system (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... SDS was removed and proteins were first digested with Lys-C (Wako) and subsequently with Trypsin (Promega) with an enzyme to protein ratio (1:50) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were stored at −20°C or used immediately in a Dual-Glo luciferase assay (Promega #E2920) with the SpectraMax ID5 microplate reader ...
-
bioRxiv - Neuroscience 2021Quote: DNase treatment was then performed (RQ1 10x buffer, RQ1 DNase by Promega, 30 minutes at 37°C) and stopped by adding 1 μL of DNase Stop Solution (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein digestion was performed overnight at 37 °C in a shaking incubator using 0.12 μg trypsin (Promega) at an enzyme to protein ratio of 1:50 (protein content was calculated using independent samples) ...
-
bioRxiv - Immunology 2021Quote: ... and then lung lobes were inflated with 3% (w/v) 45°C prewarmed low-melting agarose (Promega). The inflated lung lobes were immediately removed and cooled on ice for 15 minutes ...
-
bioRxiv - Systems Biology 2019Quote: ... Proteins were digested on-filter (16 hr, 37 °C) with sequencing-grade modified trypsin (50:1, Promega). Proteolysis was terminated and peptides eluted with 20 μL of 10% trifluoroacetic acid followed by centrifugation (13,000 ×g ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was treated with RQ1 DNase for 30 minutes at 37°C (Promega, Cat No: PAM6101). The DNase reaction was stopped with RQ1 Stop Solution for 10 minutes at 65°C (Promega) ...
-
bioRxiv - Genetics 2020Quote: ... for 3 hours at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega #N2111, Madison, WI), and PE2 mRNA was purified with MEGAclear™ Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... protein samples were treated with Endoprotease Lys-C (Wako) and Trypsin (Trypsin Gold Mass Spec Grade; Promega). Peptide samples were desalted by OMIX C18 pipette tips (Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Biochemistry 2021Quote: ... for 1 h at 37°C (sample to enzyme ratio 1:20) and then with GluC (Promega) (1:40 ratio ...
-
bioRxiv - Immunology 2021Quote: ... 50 mM Tris-Cl (pH 8) prior to digestion with Trypsin/Lys-C Mix (Promega, Madison, WI) at a ratio of 1:25 (enzyme ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was prepared from bacterial cultures grown at 37 °C using PureYield™ Plasmid Midiprep System (Promega) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... and samples were digested over night with Lys-C (Wako) followed by 4h digestion with Trypsin (Promega) at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... the samples were incubated overnight at 37°C with 0.01 μg/μL of trypsin (Promega, Madison, WI) and dissolved in 50 mM ammonium bicarbonate ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were reduced and alkylated followed by overnight digestion at 37°C using LysC / Trypsin proteases (Promega) and isobaric labelling using tandem mass tags (TMT ...
-
bioRxiv - Microbiology 2023Quote: ... the modified region was amplified using primer SAM_Seq_Gen-23_FW (5’-GAT TTG AGG ACG ACT GGA CTG C) and SAM_Seq_Gen1116_RV (5’-GTC AAC TGA ACA ACC CCA AGG T) together with GoTaq polymerase (Promega), followed by cloning into pGEM T-easy vector system (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested in-gel overnight at 37°C with Sequencing Grade Modified Trypsin (Promega; cat. #V5111) diluted in 200uL of digestion buffer (40 mM ammonium bicarbonate ...
-
bioRxiv - Systems Biology 2023Quote: ... then proteins were digested with 1 μg of mass spectrometry grade Trypsin/Lys-C enzyme mix (Promega) in 50 μL of digestion buffer (100 mM ABC ...
-
bioRxiv - Cell Biology 2023Quote: ... digested overnight at 37°C in the presence of 1.5 µg of sequencing grade modified trypsin (Promega). The resulting peptides were vacuum-dried in a vacuum concentrator to approximately 200 µL ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were digested overnight (21 h) at 37 °C with 0.1 μg/μL trypsin (sequencing grade, Promega) dissolved in 1 mM HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... on-column trypsin digestion was performed by adding by mass spectrometry grade trypsin/Lys-C mix (Promega) in a 50 mM NH4HCO3 buffer overnight at 37 °C.
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated overnight at 37°C with sequencing grade modified trypsin (0.01 mg/mL; Promega Corporation) to allow protein digestion ...
-
Pan-tissue mitochondrial phenotyping reveals lower OXPHOS expression and function across tumor typesbioRxiv - Biochemistry 2023Quote: ... 1mM CaCl2 for overnight digestion via trypsin at 32°C (Promega, Cat# V5113; 1:50 w:w enzyme:protein). Following digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then subjected to digestion with LysC (Wako) at 37°C for 2h and trypsin (Promega) overnight at 37°C at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Genetics 2024Quote: ... then a 5 min final extension (72 °C)—was carried out with GoTaq Green Master Mix (Promega). Deletion loci from mutant flies were amplified using the genotyping primers above with four GoTaq Green PCR reactions per line ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples were further digested overnight at 37 °C with the addition of sequencing grade chymotrypsin (Promega) to a final protease:protein (w:w ...
-
bioRxiv - Pathology 2024Quote: ... at a 1:50 wt:wt ratio alongside Lys-C at a 1:25 wt:wt ratio (Promega, VA1170) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2024Quote: ... alkylated with 10 mM iodoacetamide and subject to sequential protein digestion with Lys-C and trypsin (Promega). Digestion was halted with formic acid ...
-
bioRxiv - Genomics 2024Quote: ... We amplified the Cytochrome c oxidase subunit I (COI) for individual abdomen DNA using the GoTaq (Promega) protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and a total of 300 ng treated-RNA was used for reverse transcription reaction with ImProm-II Reverse transcriptase (Promega, Madison, WA, USA). The RT-qPCR was assessed on a Real-time PCR StepOne Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the first-strand cDNA was synthesized from 1 μg of total RNA with oligo dT or random primers using ImProm-II reverse transcriptase (Promega, Madison, WI, USA). The qPCR reactions were performed in a 20 μL reaction mixture using SYBR Green PCR Master Mix (Roche ...
-
bioRxiv - Physiology 2020Quote: ... The beads were resuspended in 10 μl of reverse transcriptase mix (100□U, SuperScript II, Invitrogen; 10 U, RNAsin, Promega, Madison, Wisconsin, USA), 1□×□Superscript II First-Strand Buffer ...
-
bioRxiv - Genomics 2019Quote: ... To this was added: 1 µl of EcoRV-digested pBlueScript KS II+ (∼100 ng) that had been treated with calf intestinal phosphatase (Promega Corp., Madison, WI), and 0.1 µl of T4 DNA ligase (NEB) ...
-
bioRxiv - Physiology 2020Quote: ... 500 ng of RNA were reverse-transcribed into cDNA using oligo(dT)16 and ImProm-II TM Reverse Transcriptase (Promega Corp., Madison, USA). cDNA products were amplified on a GeneAmp 7500 Fast System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...