Labshake search
Citations for Promega :
8651 - 8700 of 9065 citations for Total Carbohydrate Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Cells were harvested by trypsinization and RNA was isolated using Maxwell LEV simply RNA Cells/Tissue Kit (Promega, Madison, USA), according to the company’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Both human cell lines were validated using the cell line authentication service at Duke University and confirmed using the GenePrint 10 kit from Promega and tested to be mycoplasma-free ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Table S4).
-
bioRxiv - Microbiology 2019Quote: ... synthesized by in vitro transcription of a NdeI-linearized pGEM-T plasmid containing the 135bp cDNA target fragment using the T7 RiboMAX in vitro transcription kit (Promega). Negative controls (without template RNA and RNA from mock-infected cells ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The overlapping PCR products were separated and purified by the Spin Column PCR Product Purification Kit (Wizard SV Gel and PCR Clean-Up System) following manufacturer’s instruction (Promega, WI). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase digestion of cellular RNA was verified by purifying RNA from supernatant after immunoprecipitation using Reliaprep RNA purification kit (Promega) and then analyzing it by denaturing formaldehyde-agarose gel electrophoresis followed by imaging of the ethidium bromide stained gel.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... were detected by the alteration of the dose-response curve measured using CellTiterGlo Chemoluminescent Kit (Promega Corporation, Cat. No.: G7573). Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 ° C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The number of bacteria in the seed and root was calculated based on the values of Ct (cycle threshold ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then excised and purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega, Madison, WI) according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Amplification products were checked on a 1% agarose gel and were purified using the Wizard PCR clean-up kit (Promega). DNA concentration and purity were measured using a ND-1000 UV-Vis Spectrophotometer (Nanodrop Technologies).
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 °C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The reference DNA was diluted in series of 10−2 to 10−8 (20 – 2 × 109 ng of DNA) ...
-
bioRxiv - Microbiology 2020Quote: ... The full-length cDNA and EcoRI digested pKTO-IBV-N were subjected to in vitro transcription using T7 transcription kit (Promega), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... from 12-72 hpt and luciferase activity was measured using the Dual Luciferase reagent kit and GloMax multi detection system (Promega). Firefly luciferase readings from the TBEV replicons were normalized to the Renilla values (pTK-Ren ...
-
bioRxiv - Microbiology 2021Quote: Extraction of cellular DNA and viral DNA was conducted using Wizard® Genomic DNA Purification Kit (Promega, Madison, Wisconsin, USA) and QIAamp MinElute viral DNA extraction kit (QIAGEN ...
-
bioRxiv - Plant Biology 2020Quote: ... Gene PCR products of 200-300 bp were labelled with 32P-dCTP following the prime-a-gene labelling kit instructions (Promega) and used as probes (Supplementary Table 1) ...
-
bioRxiv - Genetics 2021Quote: ... Cell death was analyzed similarly using a commercially available kit that labels fragmented DNA from apoptotic cells (DeadEnd Fluorometric TUNEL System, Promega).
-
bioRxiv - Synthetic Biology 2020Quote: Cells from HAC-containing clones have been harvested and genomic DNA has been collected using Maxwell DNA purification kit (Promega). qPCR analysis have been performed using SYBR Green Master Mix (Roche ...
-
bioRxiv - Zoology 2020Quote: ... Genomic DNA was extracted from the selected body part using Promega Wizard® Genomic DNA Purification kit (A1120, Promega, UK) and DNA dissolved with 100 ul of molecular water and stored in −20°C for the future use.
-
bioRxiv - Microbiology 2020Quote: ... PCR reaction mixtures were solved in 1% (w/v) agarose gel and purified by means of Wizard SV gel and PCR Clean Up kits (Promega). The amplified gene was treated with Taq polymerase (Fermentas ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was purified using the Direct-Zol RNA Microprep Kit (Ozyme) according to the recommendations provided and was quantified using the QuantiFluor RNA system (Promega). One μl of 10 μM of oligo-dT primer and 1 μl of 10 μM of dNTPs were added to 0.3 ng of total RNA in a final volume of 2.3 μl ...
-
bioRxiv - Biophysics 2019Quote: ... coli HB101 cells and isolated in quantity by using a Promega Wizard Plus Megaprep purification kit (Promega Corp., Madison, WI).
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: Southern blotting was performed in accordance Koch et al.19 Genomic DNA was prepared using the Wizard Genomic DNA Purification kit (Promega) and digested with SspI-HF and MfeI-HF (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... we extracted the genomic DNA from two samples of each group using the Wizard Genomic DNA purification kit (Promega, A1120). The DNA concentration was measured by the Qubit dsDNA Broad-Range Assay (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... An overhang was added to purified Or67b amplicons with Taq polymerase (Fermentas) and cloned using the pGEM-T Easy cloning kit protocol (Promega). Plasmids were extracted and purified using the GenElute plasmid miniprep kit (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... RNAs were reverse transcribed to produce cDNAs by using the GoScript™ Reverse Transcription System Kit (Promega, cat. no. A5003). The cDNAs were then used for qPCR to evaluate gene expression ...
-
bioRxiv - Microbiology 2021Quote: ... as described previously(40) and 1 μg of RNA was reverse transcribed to cDNA using the ImPromIITM Reverse Transcriptase kit (Promega), according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... Cells were lysed 24 hours post-transfection with 1x Passive Lysis and reporter activities measured using a dual luciferase kit (Promega).
-
bioRxiv - Microbiology 2021Quote: ... n=4 vaginal) and rUTI (n=3 urine) cohorts belonging to B2 phylogenetic group was extracted (Wizard Genomic DNA Purification Kit, PROMEGA) and sequenced by Illumina NovaSeq 2×150 nt ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted from a small piece of muscle tissue by using a Maxwell RSC Blood DNA Kit with a Maxwell RSC Instrument (Promega). A shotgun DNA library was constructed using a TruSeq Nano DNA High Throughput Library Prep Kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... and 24 hours later cells were lysed with Passive Lysis 1x and reporter activities measured with Dual Luciferase Reporter Kit (Promega). At the same time supernatants from p1 cells were cleared by centrifugation and passaged onto fresh HEK293T-TIM1 p2 target cells ...
-
bioRxiv - Biochemistry 2021Quote: i3Neurons were transfected with 2 μg of plasmid (SNAP-TM-Halo or Halo-TM-SNAP) per 25 mm coverslip using a calcium phosphate transfection kit (Promega), according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: Approximately 6 × 107 control cells and 2 × 107 sort2 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (A1125, Promega). Approximately 325 μg of genomic DNA from control cells and 60 μg of genomic DNA from sort2 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Firefly luciferase activity was measured at 550 to 570 nm wavelength and followed by 100 μl of 1X Stop & Glo Reagent (part of the kit E1910, Promega) was added to each well ...
-
bioRxiv - Genetics 2021Quote: ... all clippings from both hands and feet were used to extract genomic DNA with DNA IQ Casework Pro Kit (#AS1240, Promega) and Tissue and Hair Extraction Kit (#DC6740 ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from cells using the ReliaPrep™ RNA Miniprep System kit in accordance with the manufacturer’s protocol (Promega). RNA was reverse transcribed using the Applied Biosystems™ high capacity RNA to cDNA™ Kit in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Chromosomal DNA was extracted from cultures of cells at both mid-exponential growth phase and (non-replicating) stationary growth phase using the Wizard genomic DNA extraction kit (Promega), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... glacialis A3 by filtering cells onto a 3-μm polycarbonate filter and using the Wizard SV Genomic DNA Purification kit (Promega) following the manufacturer’s instructions and quantified on a Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA from each isolate to be sequenced was purified using the Wizard Genomic DNA Purification Kit (Promega, Fitchburg, WI) and libraries were constructed and indexed using NexteraRTM DNA Library Prep Kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... After 48-72 h luminescence was assessed as a proxy of infection by lysing cells with the Bright-Glo luciferase kit (Promega), using a Glomax plate reader (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was extracted from about 35 mg of tissue using the Maxwell™ 16 Tissue DNA purification kit (Promega) and total DNA concentrations were normalized to 20 ng/µl ...
-
bioRxiv - Immunology 2020Quote: ... Media was removed and cells were washed in PBS before re-suspension in 75 μL 1X Passive Lysis Buffer (PLB; Dual-Luciferase Reporter Kit, Promega). Cells were incubated in PLB for 15 min at RT and further homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a DNase I treatment and a subsequent reverse transcription with oligo d[T]18 using the GoScript RT kit (Promega). One-step RT-qPCR was performed using the SYBR FAST Mix optimized for LightCycler 480 (KAPA ...
-
bioRxiv - Immunology 2020Quote: ... 293T cells were co-transfected with envelope-expressing plasmid and an env-deleted HIV-1 backbone plasmid (pSG3ΔEnv) using a FuGENE6 transfection kit (Promega Inc.). Cell supernatants containing pseudotyped viruses were harvested 48 h post transfection and used for infection in TZM-bl cells using DEAE-dextran (25 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells were transiently transfected with plasmid DNA pHIV-1 NL4·3Δenv-Luc and Spike-Δ19-D614G by using Profection mammalian transfection kit (Promega Inc) following the instructions in the kit manual ...
-
bioRxiv - Immunology 2020Quote: ... Total DNA from blood and urine (around 50 μL) was extracted using a Maxwell 16 automat with the Maxwell blood DNA and cell LEV DNA purification kits (Promega), respectively ...