Labshake search
Citations for Promega :
801 - 850 of 2640 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The vector was transfected into Flp-In™ 293 cells using Fugene 6 (Promega, E269A) and 24 hours later the cells expressing the fluorescent reporter were sorted in a 96 well plate as single cells using the Sony SH800 cell sorter ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were transfected with 6 µg plasmid per plate with FuGENE HD (Promega, E2311) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 148 μl opti-MEM was added to 12 μl FuGENE 6 transfection reagent (Promega, E2691). These solutions were incubated separately for 5 mins at RT ...
-
bioRxiv - Immunology 2024Quote: ... pHIT60 and 10μg pMX/TCR using Fugene-6 according to protocol (Promega, Madison, WI, USA). Transfection medium was changed for T-cell medium after 24h and supernatant was harvested 16 hours later following cell-pelleting ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viability was assessed 6 days post-treatment by using an MTS/PMS (Promega #PR-G1112) solution and reading absorbance at 490 nm on an Infinite M200 Pro plate reader (Tecan ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Immunology 2021Quote: ... in a mixture with 20 μl OptiMEM and 1μl FuGENE HD or FuGENE 6 (Promega E2691) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) for 6 hours and trypsin (Trypsin Gold, Promega) overnight.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were cultured in DMEM+10% FBS+Penicillin/Streptomycin and transfected using FuGENE 6 (Promega). Co-recruitment assays were performed 24 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: All VLPs were produced by transient transfection of HEK293T cells with Fugene 6 (Promega, ref E2691). HEK293T were seeded in 15-cm dishes to reach 60-70% confluency the next day and VLPs were produced by co-transfecting plasmids encoding Gag-eGFP and the VSV-G envelope (pGag-EGFP and pCMV-VSV-G ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: Three wells of a 6-well plate were lysed were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17,000 g ...
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV-hyPBase was performed using 500 ng each DNA and 6 μl of FugeneHD (Promega) as per manufacturer’s instructions20,49,50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Sf21 insect cells were transfected with PLP/DM20 bacmid using Fugene 6 transfection reagent (Promega Corp.) and baculoviruses were collected and used for preparation of a high-titer virus stock ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... To transform the bacmid into Sf9 cells the transfection reagent FuGene 6 (Promega Corporation, Madison, USA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...