Labshake search
Citations for Promega :
801 - 850 of 2957 citations for 1 1 Dimethylsila 11 Crown 4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1 mM CaCl2 and sequencing grade trypsin (Promega, WI) was added to all protein samples at a 1:50 (w/w ...
-
bioRxiv - Microbiology 2023Quote: ... and the addition of 1:1000 Nano-Glo (Promega). The bioluminescent signal was measured using a CLARIOstar luminometer (BMG Labtech ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of RNA treated with DNase (RQ1, Promega) was reverse-transcribed by Superscript III (Life Technologies) ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 unit of Taq polymerase (Promega, Madison, WI, USA), and approximately 75 ng of schistosome genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... then with trypsin (Promega, 1:50 (protease to protein)) for 6 hours on a 37 °C shaker.
-
bioRxiv - Biochemistry 2023Quote: ... 1 U/µL Rnasin® Plus RNAse inhibitor (Promega), 2 mM DTT ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse Anti-β-Galactosidase (#Z3781, 1:200) from Promega; rabbit anti-SWS (1:1000 from Doris Kretzschmar) ...
-
bioRxiv - Microbiology 2023Quote: ... which were digested with 1 µg Lys-C (Promega) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti- mouse IgG antibody (1:1,000, #S3721, Promega).
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-p-JNK (pTPpY, Promega, USA-1:100 dilution); 8 ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Biochemistry 2023Quote: ... then with trypsin (Promega; 1:50, 37°C overnight). Samples were purified by solid-phase extraction (SepPak tC18 cartidges ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-β-galactosidase (Promega #Z378, 1:1000) or rabbit anti-mCherry (BioVision ...
-
bioRxiv - Biochemistry 2023Quote: ... For trypsin digestion 1 μg of trypsin (V5111; Promega) was added ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mg/mL Proteinase K (Promega Corporation, WI, USA) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Microbiology 2024Quote: ... and 120 μL 30 mg mL−1 lysozyme (Promega), and 30 min incubation at 35 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested with Trypsin (1:50, Promega, Cat # V5280) for overnight incubation at 37°C with intensive agitation ...
-
bioRxiv - Neuroscience 2024Quote: ... Secondary antibodies: anti-mouse-IgG (Promega, W4028, 1:2500) and anti-rabbit-IgG (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested with Trypsin (1:50, Promega, Cat # V5280) for overnight incubation at 37°C with intensive agitation ...
-
bioRxiv - Plant Biology 2024Quote: ... leaves were sprayed with 1 mM D-luciferin (Promega) and incubated in dark for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 unit of RNase inhibitor (Promega, cat ID# N251B) and micrococcal nuclease (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1% Nluc substrate (Nano-Glo, Promega, Madison, USA) in the presence of release factors (50 nM of eRF1 alone ...
-
bioRxiv - Systems Biology 2024Quote: ... 100 µl of 1:50 Furimazine:NanoGlow (Promega, Southampton UK) were added using a multipipette ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and a 1:100 dilution of LgBiT protein (Promega) was added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ng of a reference plasmid pGL3 (Promega U47296) was spiked into the DNA samples prior to loading on to the spin columns to normalize DNA elution efficiency.
-
bioRxiv - Biophysics 2024Quote: ... to which 1 uM HaloTag TMR ligand (Promega, G825A) was supplied for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... An additional volume of LysC (Promega, 1:100 ratio) was added for ∼3 hours before acidifying to pH 3-4 with 10% formic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% Triton-X100) supplemented with RNasin Plus inhibitor (Promega) and HALT phosphatase and protease inhibitors (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 μL of 10 mM dNTP (Promega, U1515) solutions were added to the mixture ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were treated with 1 μM HaloPROTAC3 (Promega GA3110) or DMSO as control ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μl M-MLV-RT enzyme (M1701, Promega). PCR was performed in a 20 μl vol ume containing 10 pmol of each primer ...
-
bioRxiv - Cell Biology 2022Quote: HeLa cells were transfected with pEGFP-N1 or pEGFP-DFCP1 and co-transfected with pcDNA3-myc-Ubiquitin using Fugene6 (Promega 2023-11-06 Lot 0000425615). 24 h later the cells were washed twice in ice cold PBS and lysed (125 mM KAc ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein digestion was performed by 1 µg of Lys-C (Wako) at 37 °C for 3 h following 1 µg of trypsin (Promega, Madison, WI, USA) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... a master mix was prepared by diluting the Extracellular NanoLuc Inhibitor at a 1:1000 ratio and the NanoBRET Nano-Glo Substrate at a 1:333 ratio in PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...