Labshake search
Citations for Promega :
751 - 800 of 1320 citations for Rat NDUFS4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Genomics 2019Quote: ... 2 μg of each of these reporter plasmids along with 100 ng of pRL-TK (Promega), a Renilla luciferase expression plasmid to control for transfection efficiency ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Cell Biology 2019Quote: ... These reporter vectors were transfected into HepG2 cells along with a β-galactosidase control plasmid (Promega) to normalize transfection efficiency ...
-
bioRxiv - Immunology 2021Quote: pCIneo Precursor miR-146a (pmiR-146a) and HA-HuR plasmids were transfected using Fugene HD (Promega) for RAW264.7 cells as described previously (Goswami et.al ...
-
bioRxiv - Biochemistry 2020Quote: ... subjected for mini-prep plasmid purification by Wizard® Plus Minipreps DNA Purification System (Promega, USA), and used as the template in subsequent PCR amplification of the given library ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used to combine the two split EPG sections with N-Terminal HaloTag Plasmid PHTN (Promega) such that the N-terminal HaloTag sequence is preceded by the signal sequence at its 5’ end and succeeded by the rest of the EPG sequence at the 3’ end ...
-
bioRxiv - Microbiology 2021Quote: ... The reporter plasmid pAP1-Luc and promoterless-RLuc (pGL4.70) were purchased from Promega (Madison, WI, USA).
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with Galectin-3-GFP plasmid (0.5 µg) using FuGene HD (Promega, Madison, WI) with a ratio of 3:1 for 24 h at 37 °C in 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were transiently transfected with 50 ng each of the appropriate plasmids using FuGENE HD (Promega) at a FuGENE DNA ratio of 3:1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The HaloTag-SmBiT fragment was PCR amplified from the commercially available plasmid (Promega, Cat no: N202A) and also subcloned into pcDNA3.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were co-transfected with the BeGC1 plasmid and the pGloSensor-42F cGMP vector (Promega) using Lipofectamine 2000 (Thermo Fischer Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... The linearized plasmids were used as templates for in vitro transcription with T3 RNA polymerase (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... BT-549 and HCC38 cells were transfected with both plasmids simultaneously (2 μg) using FuGene (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... plasmids at the designated concentrations were added to OptiMEM media with FuGENE HD Transfection Reagent (Promega) at a 3:1 FuGENE:DNA ratio ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Plant Biology 2019Quote: ... we used a control plasmid provided in the TnT® Quick Coupled Transcription/Translation System (Promega). The plasmid was linearized using the restriction enzyme SacI and purified using the DNA Clean and Concentrator Kit (Zymo Research) ...
-
bioRxiv - Immunology 2020Quote: ... All luciferase constructs were co-transfected with pRL-TK Renilla luciferase plasmid (Promega, Madison, WI, USA) to normalize transfection efficiency variation between samples ...
-
bioRxiv - Cell Biology 2020Quote: ... 1000 ng of donor and gRNA plasmids in 1:1 ratio was used using ViaFect (Promega) transfection reagent as per manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... The pTM plasmids were transfected into H7-T7-IZ cells using ViaFect™ Transfection Reagent (Promega) following the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2020Quote: Aag2 and U4.4 cells were transfected with the appropriate plasmids using Fugene HD Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids encoding the cAMP sensor (pGloSensor-22F) and the following luciferase reporters were purchased from Promega: CRE-luc2 ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA of GRXS17 (At4g04950) were inserted into the pGEM-T Easy plasmid (Promega, Madison, WI, USA). Different point mutations of cysteines to serines in GRXS17 were generated using QuikChange II Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with the plasmid of the required sensor using FuGene HD transfection reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... They were transfected with multiple plasmids at an amount of 50 ng each using FugeneHD (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The 1 μg linearized plasmid was serving as a template for in vitro transcription (SP6, Promega), and the products was then transfected into cells with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... pMAD plasmid was also digested with MluI and NcoI and dephosphorylated by addition of TSAP (Promega, streamlined restriction digestion protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmids for preparing DNA templates for in vitro transcription were assembled using the pGEM-11Zf(+) (Promega) backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid miniprep DNA isolation was performed using Wizard Plus SV Minipreps DNA Purification System (Promega, USA). Plasmid maxiprep DNA isolation was performed using NucleoBond Extra Maxi Plus EF Kit (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2021Quote: ... These recombinant plasmids were subsequently used to generate digoxigenin-labelled riboprobes using the Riboprobe System (Promega) with SP6 or T3 RNA polymerases and digoxigenin-labelled Uracil triphosphate (Roche ...
-
bioRxiv - Microbiology 2020Quote: The plasmids were transfected into the 293T cells using Fugene HD transfection reagent (Promega, Madison, WI). The culture media containing VLP were harvested 3 days post transfection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor cells were transiently transfected with the plasmid using FuGENE HD transfection reagent (#E2311, Promega, USA) according to manufacturer’s protocol and GFP+ cells were sorted ...
-
bioRxiv - Microbiology 2022Quote: ... Positive cells were multiplied and their plasmid extracted using the Wizard Minipreps DNA purification system (Promega). Plasmids were electroporated into WT B ...
-
bioRxiv - Neuroscience 2023Quote: ... The linearized plasmids were used as templates for in vitro transcription with T3 RNA polymerase (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plasmids were purified from these cultures using a Wizard Plus SV Miniprep DNA Purification kit (Promega). All inserted sequences were confirmed by Sanger sequencing using M13 forward and reverse primers (M13F and M13R ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified BAC and plasmid DNA were transfected into HEK293 cells with FuGene HD transfection reagent (Promega) in a 1:3 DNA:FuGene HD ratio ...
-
bioRxiv - Biophysics 2023Quote: We stably transfected U2OS cells with this plasmid using Fugene 6 following the manufacturer’s instruction (Promega). α-Amanitin (SIGMA #A2263 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μg of each purified plasmid was used as input in a 50 μl TnT (Promega) reaction incubated at 25 °C for 2 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cells were transfected with 1 or 1.5 μg plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... pHT315-GFP was then extracted and purified using either the Pureyield plasmid miniprep kit (Promega #A1223) or the QIAGEN® Plasmid Mini Kit (QIAGEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5μg of plasmid was transfected into 6-well dishes using Fugene HD (Promega, Madison, WI, USA) with 3:1 transfection reagent to DNA for 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega). 7 hours after transfection ...
-
bioRxiv - Physiology 2023Quote: ... cells were transfected with the indicated plasmids using FuGENE® HD Transfection Reagent (#E2311, Promega Corporation) at a ratio of 1:5 (plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmids were prepared by mini or maxi preps using commercially available kits (Qiagen and Promega, respectively) following manufacturers’ instructions ...
-
bioRxiv - Immunology 2023Quote: HTR cells were transfected with the indicated plasmids using TransFast transfection reagent (Promega,Madison, WI, USA) according to the manufacturer’s protocol as previously described [9] ...