Labshake search
Citations for Promega :
751 - 800 of 1165 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... containing 5 μL of GoTaq Master Mix (Promega, Mdison, WI, USA), 1 mM each of forward and reverse primer ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR genotyping was conducted using GoTaq® Green Master Mix (Promega) in a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Cancer Biology 2020Quote: ... the target sequences were amplified using GoTaq Green Master Mix (Promega). The primers for RT-PCR are listed in Supplementary Table S4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The reaction mix included: 7.5μl of GoTaq Green master mix (Promega), 0.4μl of each primer (10μM ...
-
bioRxiv - Neuroscience 2021Quote: ... GoTaq G2 Hot Start Green Master Mix (Promega, cat no. M7423) was used together with primers list in table 1 to perform reverse transcription PCR reaction ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was conducted in Promega PCR master mix (Promega, Madison, WI). SYBR green-based qPCR and probe-based qPCR was conducted in SsoAdvanced universal SYBR green supermix (Bio-Rad Canada ...
-
bioRxiv - Cell Biology 2019Quote: Gene expression was quantified using Go Taq Green Master Mix (Promega) and the LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were done using 12.5 μL Master Mix 2X (Promega), 1.25 μL DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Cell Biology 2019Quote: ... and human samples were performed using GoTaq green master mix (Promega) and the following amplification conditions ...
-
bioRxiv - Microbiology 2020Quote: ... followed by amplification using GoTaq colorless Master Mix (Promega, Madison, WI) (36) ...
-
bioRxiv - Microbiology 2022Quote: ... A master mix of transfected cells with 1x Endurazine™ (Promega) and 1 µM DrkBiT peptide (VSGWALFKKIS ...
-
bioRxiv - Molecular Biology 2023Quote: ... two reactions containing 40 μL TnT SP6 Quick Master Mix (Promega), 2 μL of 1 mM methionine and 1 μg of pCMV-Sport were incubated for 90 minutes at RT ...
-
bioRxiv - Microbiology 2023Quote: ... The amplification was performed using GoTaq Long PCR Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplification was performed using GoTaq® Master Mix (Promega, M7122), with the following conditions ...
-
bioRxiv - Physiology 2024Quote: ... 18 µl of PCR master mix which includes MM (Promega #xxx), 1ul of Forward/Reverse primers (10mM) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using GoTaq® Long PCR Master mix (Promega) and each reaction consisted of ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using the Go TaqTM Master Mix (PRM7123, Promega).
-
bioRxiv - Bioengineering 2023Quote: Yeast-colony PCR was performed using green GoTaq Master Mix (Promega) as per the manufacturer’s protocol (dx.doi.org/10.17504/protocols.io.bp2l69p95lqe/v1 ...
-
bioRxiv - Genetics 2024Quote: ... and 10 µL of power SYBR green PCR master Mix (Promega). The real-time qPCR was performed using a fluorescent quantitative detection system (FQD-96A ...
-
bioRxiv - Neuroscience 2023Quote: ... TRPV2 and TRPC3 using GoTaq Green Master Mix (Promega, Madison, USA) were performed ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments were amplified using GoTaq master mix (Promega Cat #M7123). Plasmids were introduced into AMB-1 through conjugation and are listed in supplementary table S2.
-
bioRxiv - Plant Biology 2023Quote: ... were performed using GoTaq G2 Green Master Mix (Promega, cat#M7822). Secondary validation of genotyping reactions was performed as needed using the Quick-DNA Plant/Seed Miniprep kit (Zymo Research ...
-
bioRxiv - Microbiology 2019Quote: Reverse transcriptase (RT)-PCR was carried out using ImProm-II reverse transcriptase (Promega) following the manufacturer’s protocol with 1 µg of RNA ...
-
bioRxiv - Physiology 2020Quote: ... with cDNA produced using the ImProm-II RT system (Promega, Madison, WI, USA). Real-time quantitative PCR was performed using a Prism 7000 (Applied Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... pre-treated with DNAse (50u/ml, 15min RT, RQ1 RNAase free DNAse, Promega) and cytoplasmic fractions were adjusted ...
-
bioRxiv - Pathology 2021Quote: ... and reverse transcription (RT) was performed using MMLV reverse transcriptase (Promega, Charbonnieres, France), as recommended by the manufacturers ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega, Madison, WI), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA was further reverse transcribed to cDNA using MMLV-RT (Promega, USA) and used for downstream mRNA qPCR assays ...
-
bioRxiv - Genomics 2022Quote: ... and cDNA synthesis using the GoScript RT Kit and oligo dT primer (Promega). To amplify the random 5’ and 3’ BC from the plasmid DNA or cDNA sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription was performed with M-MLV RT Enzyme (Promega, Madison, WI, USA) and oligo-dT (T12 and T16 mix ...
-
bioRxiv - Microbiology 2022Quote: ... Relative quantitative PCR analysis was performed using the GoTaq qPCR SYBR mastermix (Promega) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR was performed using Gotaq® qPCR mastermix (Promega, Madison, WI) and a CFX 96 real-time system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Genetics 2022Quote: ... DNA (50 ng) was amplified using 1X GoTaq Green Master Mix (Promega), 0.8 μM oligonucleotides and 5% DMSO up to a volume of 20 μL ...
-
bioRxiv - Genetics 2019Quote: ... 15 µL of 2x GoTaq Hot Start Green Master Mix (Promega, USA), 0.3 µL of 10 µM forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... and GoTaq®aPCR Master Mix with SYBR green fluorescence (Promega, Germany). PCR primer sequences were retrieved from the Primer Bank database (Spandidos et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR followed standard conditions using GoTaq®Green Master Mix (Promega corp.), Ta= 58°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed using GoTaq PCR Master Mix (Promega) or PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic PCR was carried out using GoTaq HotStart Green Master Mix (Promega), as per manufacturer’s instruction (TRAIP F ...
-
bioRxiv - Neuroscience 2022Quote: PCR mix was run with GoTaq Green Master Mix 2x (Promega, M712B). The PCR amplification process was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... for LSL-KRas construct detection and GoTaq Green Master Mix (#M7122, Promega) for all other constructs.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Standard PCR reactions were performed using Go Taq Green Master Mix (Promega) and 0.5μmol L−1 of the primer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCRs using the GoTaq Long PCR Master Mix (Promega Corp, Wisconsin, USA) using 0.6-0.8 μM of each primer and a modified touchdown PCR protocol for the largest amplicon (Don et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Separate PCR reactions were prepared using the GoTaq® Master Mix (Promega) and primers targeting Abi3 exon 5-7 (5’→3’ Fw ...
-
bioRxiv - Immunology 2022Quote: ... PCR was performed with GoTaq® Green Master Mix (2X) (Promega Corporation) using gene-specific primers (S1 ...
-
bioRxiv - Neuroscience 2023Quote: The PCR was performed with the GoTaq® Green Master Mix (Promega), and the primers used for genotyping were as follows ...
-
bioRxiv - Physiology 2022Quote: ... PCR was performed using Go-Taq Green Master Mix (Promega, Madison, WI) and resulting products were resolved by 3% agarose gel electrophoresis ...
-
bioRxiv - Cancer Biology 2023Quote: ... All reactions were carried out using the 2X master mix from Promega.