Labshake search
Citations for Promega :
951 - 1000 of 1236 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The plate was incubated for 40 min at RT before reading luminescence using GloMax Explorer (Promega) plate reader ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with 1 μg/μL of RNA concentration using MMLV-RT enzyme (Promega, USA). HvHsfA6a gene specific and Actin primers designed by using Primer express 3.0 software (Thermoscientific USA ...
-
bioRxiv - Biochemistry 2024Quote: ... plates were equilibrated to RT for 15 min and CellTiter Glo reagent (Promega, Madison, WI, USA) was added followed by orbital shaking for 2 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR, #A600A, Promega) in a real-time PCR analysis system (StepOnePlus ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed using Promega GoTaq qPCR mastermix according to the manufacturer’s instructions (Promega, Madison, WI). Each reaction comprised 1 ng cDNA ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR amplifications for genotyping were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA), with the resulting products subjected to 3% agarose gel electrophoresis (Supplemental Fig ...
-
bioRxiv - Genetics 2021Quote: ... then a 5 min final extension (72 °C)—using GoTaq Green Master Mix (M7123, Promega) and the pCFD6_seqfwd and pCFD6_seqrev primers (Table S1 ...
-
bioRxiv - Microbiology 2021Quote: ... Successful integration was confirmed by diagnostic PCR using GOtaq Hot Start Green Master Mix (Promega). For primer sequences see Supplementary file 1.
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified with the following protocol: 1X Promega PCR Master Mix (Promega, Fitchburg, WI), 2.5µL cDNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... A master mix of 3.5uL lysate with 0.5uL 100uM complete amino acid mix (Promega L4461) and 1uL 10x translation buffer (20mM Hepes pH 8 ...
-
bioRxiv - Microbiology 2019Quote: ... PCR to confirm presence of transposon was preformed using GoTaq® Green Master Mix (Promega) and primers KanF (TGGATTGCACGCAGGTTCTC ...
-
bioRxiv - Genetics 2019Quote: ... 25 µL reactions were constructed using 1x Go-Taq colorless hotstart master mix (#M5133, Promega), 1 ng of gDNA for both an individual predicted to have a particular L1Hs insertion or an individual predicted not to have the insertion ...
-
bioRxiv - Plant Biology 2021Quote: ... colony PCR screens were conducted using GoTaq® Green Master Mix (Promega, Madison WI, USA) with the following conditions ...
-
bioRxiv - Immunology 2020Quote: The murine Linc00402 probe template was generated by PCR (GoTaq Green 2X Master Mix, Promega) amplifying a 368 nt region from C57BL/6 T cell-derived DNA using the following forward and reverse primers containing EcoRI and HindIII sites ...
-
bioRxiv - Microbiology 2020Quote: ... USA). GoTaq Green Master Mix (Cat. No. M7123) was obtained from Promega (Madison, WI, US).
-
bioRxiv - Bioengineering 2021Quote: The open reading frame for human SOX17 was PCR amplified using GoTaq Master Mix (Promega) from the PB-TRE3G-SOX17 plasmid (Table S5) ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and the PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR reaction mix used was: 10 μL GoTaq Green Master Mix (Promega, Madison, WI), 1 μL RRVP3-F3 and RRVP3-B3 or RRVP4-F3 and RRVP4-B3 primers (5 μM) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out individually for each gene using GoTaq® Green Master Mix (Promega), with primers listed in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... individual rough colonies were used to conduct colony-PCR using GoTaq Green master mix (Promega) and a primer set unique to different regions on each of the BcG9241 plasmids pBCX01 and pBC210 ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR solution for each sample contained 12.5 µL GoTaq Green Master Mix (Promega, M7123), 1.5 µL common forward primer ...
-
bioRxiv - Microbiology 2022Quote: ... and YFV_500_6_left/right) as previously described (22) using the GoTaq Probe Master Mix (Promega, USA). The amplicons were purified and sequenced with the ABI3130 platform (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 mg/ml BSA and 10mg/ml PVP in GoTaq® Green master mix (Promega Biotech India Pvt ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each DNA family was amplified with 2×GoTaq® Hot Start Green Master Mix (Promega) using 0.8–2.2 ng of germline and somatic DNA and the primer pair according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... in reactions requiring downstream usage of PCR products or the GoTaq green master mix (Promega), where downstream application was not required ...
-
bioRxiv - Biochemistry 2020Quote: ... The reverse transcriptase M-MLV RT as well as the T4 DNA ligase were obtained from Promega. The pGEM-T Vector kit was purchased from Promega ...
-
bioRxiv - Synthetic Biology 2019Quote: ... ligated for 3 h at room temperature (RT) or overnight at 4°C using T4 ligase (Promega), and propagated in E.coli XL 10 Gold cells (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell plates were equilibrated to RT for one hour and CellTiter-GloTM Luminescence Cell Viability Reagent (Promega) was added to the cell suspension ...
-
bioRxiv - Biochemistry 2021Quote: Purified RT-PCR products were cloned in to pGEM vector using pGEM- T easy vector Systems (Promega) as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complementary DNA (cDNA) was synthesized from total RNA using a RT-PCR kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The revers transcription (RT) reaction was performed by M-MLV reverse transcription kit (Promega, Madison, WI, USA).
-
bioRxiv - Microbiology 2022Quote: ... followed by lysis for qPCR analysis or detection of luminescence using a Firefly Luciferase Assay kit (Promega) and a Glomax luminometer (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... primers at a final concentration of 300nM and 6µL of GoTaq® qPCR Mix (Promega, Madison, USA). qPCR conditions were the following ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA synthesized using Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) and universal Random hexamers (Promega). qRT-PCR was performed with 2x PowerUP™ SYBR™Green Master Mix in the QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription was performed on 1 μg of RNA with random hexamer primers using MMLV-RT enzyme (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription (RT) of different HCV genomic regions was performed using avian myeloblastosis virus (AMV) reverse transcriptase (Promega), and subsequent PCR amplification was carried out using AccuScript (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of total RNA was reverse transcribed using an oligo(dT)15 and the MMLV-RT (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The reverse transcriptase enzyme M-MLV RT (H-) (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H minus, Promega) was then used to transcribe 1 µg of total RNA to cDNA using Oligo(dT)15 primers (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sequentially digested with Lys-C (Wako) (protein:enzyme ratio 1:50, o/n at RT) and trypsin (Promega) (protein:enzyme ratio 1:50 ...
-
bioRxiv - Microbiology 2022Quote: ... The reverse transcription (RT) mix contained 200 units of recombinant Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega), 20 units of RNAsin (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: A total of 10 µg RNA was taken from each sample for reverse transcription (RT) using GoScript (Promega) reverse transcriptase (5 µg for RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR for mRNA transcripts was performed by using the ImProm-II Reverse Transcription System kit (Promega A3800). Real Time PCR was performed with Applied Biosystems Fast SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCRs were performed with the GoTaq G2 Hot Start Green Master Mix (Promega, Madison, WI, USA) in an Applied Biosystems 2720 Thermal Cycler (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR reactions were performed using GoTaq®G2 Green Master Mix (Promega, WI, USA; #M7823) or Taq 2x Master Mix Kit (New England Biolabs® Inc. ...
-
bioRxiv - Physiology 2019Quote: ... Eluted DNA as well as pre-IP controls were amplified using GoTaq Green Master Mix (Promega) with primers designed for the promoter regions of Ucp1 and Sarcolipin ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR reaction was conducted in a 50 μl contained Go Taq Colorless Master Mix (Promega), 20 μM Tn5-DPO primer ...
-
bioRxiv - Microbiology 2021Quote: ... PCR verifying experiments were performed with Go Taq Green Master Mix (Promega, Charbonnières les Bains, France), and PCRs requiring proofreading were performed with the Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μL of passive reference (ROX) dye (GoTaq® Q-pcr Master Mix, cat# A6001, Promega), and 1.1 μL of nuclease-free H20 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μl of the gDNA were added to a GoTaq® Green Master Mix (Promega, USA) and used to amplify part of the mitochondrial cytochrome oxidase 1 (CO1 ...