Labshake search
Citations for Promega :
701 - 750 of 1357 citations for 6 TERT BUTYLQUINOLINE 98.0+% GC T since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 2.25 μg psPax2) and 18 μL of FuGENE 6 (Promega). The culture medium was changed 6-24 h later ...
-
bioRxiv - Cell Biology 2023Quote: Cells expressing one plasmid were transfected with FuGENE 6 (Promega #E2691) at a FuGENE:DNA (μL:μg ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the indicated plasmids using FuGENE 6 (Promega) or Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... then digested by treatment with 6 µl of Trypsin Gold (Promega). Peptides were extracted and concentrated for MS analysis.
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid transfections were carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufactureŕs protocol.
-
bioRxiv - Microbiology 2023Quote: ... and DNA transfection was performed using Fugene 6 reagent (E2691, Promega). 1 μg of MPXV DNA was mixed with 3 μl of Fugene 6 reagentin 100 μl Opti-MEM medium for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid transfection was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... then transfected with 1.5 µg plasmid DNA using FuGENE 6 (Promega) as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... The PCR amplification product was cloned into a pGEM®-T-Easy vector (Promega, Madison, Wisconsin) and named pHaHB4.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cloned into the pGEM-T Easy vector according to the manufacturer’s instructions (Promega) and sequenced using predesigned primers against the T7 promoter (MWG Eurofins).
-
bioRxiv - Microbiology 2021Quote: ... and was reverse transcribed into cDNAs using oligo-d(T) and M-MLV reverse transcriptase (Promega). Real-time PCR was performed with the specific primers listed in Table 2 using the LightCycler 480 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... The calibration curves were generated using serial dilutions of pGEM-T Easy plasmid DNA (Promega, USA) carrying a single copy of the target gene fragment (qp1F/qp1R) ...
-
bioRxiv - Plant Biology 2022Quote: ... The two PCR-amplicons were fused by overlap extension PCR and cloned into pGEM-T (Promega) by TA cloning ...
-
bioRxiv - Cell Biology 2019Quote: ... The MultiSite Gateway cassette was then ligated into pGEM-T Easy Vector (Promega UK, Southampton, UK) and the insert sequence was confirmed by sequencing (Source BioScience ...
-
bioRxiv - Plant Biology 2019Quote: ... of the entire or partial coding sequences cloned in pENTR vector or pGEM T-easy (Promega) and digested with respective endonuclease enzymes ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Genomics 2020Quote: The mid-transcript PCR product was ligated to pGEM®-T Easy vector (Promega Corporation, USA), following the manufacturer’s instructions and transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... The fragment was then cloned using T/A cloning in the pGEMT vector (Promega, ref#A1360). For the Rsp satDNA probe ...
-
bioRxiv - Genomics 2021Quote: ... The amplicons were gel-purified and cloned into pGEM®-T Easy Vectors (Promega, Cat. #: A1360) using standard TA cloning techniques ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the amplified PCR products were ligated into the pGEM-T easy vector (Promega Madison, WI) for DNA sequence verification ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
The anti-lipidemic drug simvastatin modulates Epigenetic Biomarkers in the Amphipod Gammarus locustabioRxiv - Pharmacology and Toxicology 2020Quote: ... product identity was confirmed by cloning in pGEM®-T Easy Vector Systems (Promega Corporation, USA), followed by Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: The respective pair of target locus homologous arms were cloned into pGEM-T Easy vector (Promega). Subsequently ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 T cells were co-transfected with the target receptor construct and GloSensor cAMP reporter (Promega) in DMEM supplemented with 10% FBS for overnight incubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ARF3 coding region was amplified by RT-PCR and cloned into pGEM-T-easy (Promega). The resulting plasmid was digested with SpeI and transcribed with T7 RNA polymerase to generate the antisense probe ...
-
bioRxiv - Neuroscience 2021Quote: ... the Gbait-hsp70 fragment and QF2 fragment were independently inserted into pGEM T-easy (A1360, Promega) and subsequently combined into one vector by SacII digestion and ligation (Addgene ...
-
bioRxiv - Developmental Biology 2019Quote: ... purpuratus embryos and the 650 bp product was cloned using the pGEM-T Easy system (Promega). Protein expression was induced in E ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Plant Biology 2019Quote: ... HvSNF7.1 was ligated into the vector pGEM®-T Easy (#A1360, Promega, Madison, Wisconsin, United States). All the clones were verified by sequencing and finally cloned into the target vectors pGADT7 AD (#630442 ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA of GRXS17 (At4g04950) were inserted into the pGEM-T Easy plasmid (Promega, Madison, WI, USA). Different point mutations of cysteines to serines in GRXS17 were generated using QuikChange II Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Plant Biology 2019Quote: ... Enriched DNA fragments were amplified and cloned using the pGEM-T easy vector (Promega, Madison, USA) and transformed into XL1-BLUE Escherichia coli competent cells (Stratagene ...
-
bioRxiv - Genetics 2019Quote: ... The 5 kb CcMoY fragment was then cloned in the pGEM®-T Easy vector (Promega) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and MleKlfX were amplified from cDNA (Table 1) and cloned into pGEM-T Easy vector (Promega). The cloned fragments were used as templates for in vitro transcription (MEGAscript ...
-
bioRxiv - Immunology 2021Quote: ... and fibina were amplified from WT embryonic cDNA and cloned in pGEM®-T Easy (Promega). Primers used for each amplification are listed in Supplementary Methods (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting products were cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA). After plasmid linearisation ...
-
bioRxiv - Cell Biology 2022Quote: ... the PkHSP70 5’UTR sequence was amplified and inserted into a pGem-T Easy vector (Promega) followed by the Cre60 sequence via restriction cloning between XhoI/KpnI sites ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was cloned into the pGEM-T Easy vector system (Promega, WI, USA) and then digested with the restriction enzymes ...
-
bioRxiv - Microbiology 2022Quote: ... A 666 bp fragment of MycFOLD-17 cDNA was amplified using the gene-specific primers MF17_ISH_F (ATGAGAATATTTTCGGCTCAA) and MF17_ISH_R (TCAGTCAGTTATCCAAGCAGC) and ligated into the pGEM-T Easy vector (Promega) and used as a template for in vitro transcription using the Digoxygenin (DIG ...
-
bioRxiv - Microbiology 2023Quote: The genes were cloned one by one into in pGEM-T Easy Vector (Promega, Madison, USA) and finally in pMG36e vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified DNA was ligated into a pGEM-T Easy pre-linearized vector (Promega, catalog no. A1360) and transformed into DH5α competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves from the amplification of the cloned target sequence in a pGEM-T vector (Promega) were used to quantify 16S total copy number per sample.
-
bioRxiv - Plant Biology 2023Quote: ... LSH3 and LSH4 were transcribed from pGEM®-T Easy with T7/SP6 RNA polymerase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The fused PCR fragment was then cloned into the pGEM-T Easy vector (Promega, Madison, WI) generating flgE::kan ...
-
bioRxiv - Biochemistry 2023Quote: ... reverse: ACT CTT GCT CTG GCT TGA TGA T) together with 2x GoTaq master mix (Promega) and commenced the reaction according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Luciferase activity was measured in purified CD8 T cell lysates with the luciferase assay system (Promega). Purified CD8 cells were lysed using cell lysis buffer 1X ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids encoding different Ocrl1 mutants were transfected using Fugene 6 reagent (Promega) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: DNA was transiently transfected into cells using FuGENE 6 transfection reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Microbiology 2022Quote: All ectopic transfections were performed using FuGENE® 6 Transfection Reagent (Promega) according to the manufacturer’s instructions ...