Labshake search
Citations for Promega :
651 - 700 of 4976 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and PCR was run using GO Taq Green Mastermix (Promega). Primers and protocols used were obtained from JAX ...
-
bioRxiv - Genomics 2024Quote: ... Traditional genotyping PCR was completed with GoTaq (Promega, Madison, WI) and all real-time qPCR was completed with the StepOnePlus (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was performed using GO-Taq Flexi DNA Polymerase (Promega) using primers listed in Supplementary Table S4 ...
-
bioRxiv - Cell Biology 2024Quote: PCR reaction (Promega Gotaq G2 Master mix 2X (Promega, M7822) 25uL ...
-
bioRxiv - Cell Biology 2024Quote: PCR reaction (Promega Gotaq G2 Master mix 2X (Promega, M7822) 25uL ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were cloned in pGEM-T vector (Promega, #A3600). FITC or DIG-labeled RNA probes were generated by in vitro transcription with SP6 or T7 polymerase ...
-
Exploring the interspecific interactions and the metabolome of the soil isolate Hylemonella gracilisbioRxiv - Microbiology 2022Quote: ... gracilis 16S rRNA PCR was performed from grown colonies in a 50 μl PCR-GoTaq™ green master mix (Promega Corp. Madison, USA cat# M712). For 16S rRNA gene amplification the following primers were used ...
-
bioRxiv - Plant Biology 2020Quote: ... the PCR products were cloned into pGEM-T Easy plasmid (Promega) for propagation and sequencing (GATC Biotech ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were cloned into the pGEM-T vector (Promega). Sequencing of the inserts from a dozen of subclones in each case allowed us to ascertain the edits in TMEM70 exons ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR products were inserted into pGEM-T Easy vector (Promega). Sequences encoding the full length and parts of Tdrd3 were cloned into pCS2-Flag-N or pCS2-Flag-C to produce Tdrd3 fused with Flag at the N- or C-terminus of Tdrd3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nested PCR products were cloned into pGEM-T vector (Promega) and the nucleotide sequence was determined by Sanger sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and real-time PCR performed using GoTaq qPCR Master mix (Promega) on ABI QuantStudio 7 Flex Real Time PCR System ...
-
bioRxiv - Neuroscience 2021Quote: ... site-directed mutagenesis was performed using PCR with Pfu polymerase (Promega; mutagenesis primers 5’ to 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using GoTaq G2 (M7845, Promega, Madison, WI, USA) according to manufacturer’s instructions with the primers Dsg2-W2A for ...
-
bioRxiv - Cell Biology 2021Quote: ... Qualitative PCR was performed with GoTaq® qPCR Master Mix (Promega) and a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2021Quote: ... purified using Wizard SV Gel and PCR Clean-Up System (Promega), and all 4 reactions were pooled together ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR amplicon obtained was ligated to pGEM-T Easy vector (Promega). Competent cells E ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the GoScriptTM Reverse Transcription System (Promega) and a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned using the pGEM-T Easy System (Promega) and sequence determined by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR genotyping was conducted using GoTaq® Green Master Mix (Promega) in a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... After initial cloning of the PCR amplificate into pGEM-T (Promega), the coding sequence was excised with BamHI/EcoRI and ligated downstream of the His tag into the multiple cloning site MCS1 of pETDuet-1 (ampicillin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using GoTaq® Colorless Mastermix (Promega, Madison, USA), 0.4 μM of each primer and 2 μL DNA ...
-
bioRxiv - Cell Biology 2021Quote: PCR was performed using GoTaq DNA polymerase (Promega, Fitchburg, WI, USA) according to the manufacturer’s guidelines with the following primers for eEF2 (AGGTCGGTTCTACGCCTTTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR was performed with GoTaq G2 Green Master Mix (Promega) and gene specific primers ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR fragment was subcloned into pmiR-GLO reporter vector (Promega) at the SacI and XbaI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified by 15 PCR using GoTaq G2 polymerase (Promega) and TruSeq_adaptor_fwd and TruSeq_adaptor_rev primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Q-PCR reactions were performed using GoTaq qPCR Master Mix (Promega) in a CFX96 Real-Time System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for PCR genotyping with GoTaq® Green Mastermix (Promega) and Sanger sequencing was then extracted using QuickExtract™ DNA Extraction Solution (Lucigen) ...
-
bioRxiv - Microbiology 2021Quote: ... in the dNTPs used for the PCR (GoTaq DNA polymerase, Promega). The fixed membrane was incubated overnight at 68°C in presence of the hybridization probes and revealed using a biotin chromogenic detection kit (K0661 ...
-
bioRxiv - Molecular Biology 2020Quote: The coupled Transcription/Translation system (T7 Quick for PCR DNA, Promega) was used to express ATFS-1 from a PCR template ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-PCR to validate splicing changes was performed using GoTaq (Promega) and quantified with Bioanalyzer RNA 6000 Nano assay (Agilent).
-
bioRxiv - Evolutionary Biology 2022Quote: ... These PCRs were performed using the GoTaq G2 DNA mastermix (Promega) for 30 cycles with 30s at 95°C denaturation ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into the luciferase pNL1.1 vector (Promega) and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Successful clones were screened by colony PCR using GoTaq polymerase (Promega) and sequenced by Sanger sequencing (Genewiz Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). PCR amplicon sizes for CRKL ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). Surveyor was performed using IDT Surveyor kit (IDT #706020 ...
-
bioRxiv - Microbiology 2020Quote: ... The reagents used for PCR were obtained from Promega (Madison, WI) and a total volume of 25 μl reaction mixture for PCR amplification was carried out ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR reaction was performed with the GoTaq Green Mastermix (Promega) in a total volume of 50 µl in the presence of 0.2 µM of each oligo ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were done using 12.5 μL Master Mix 2X (Promega), 1.25 μL DMSO ...
-
bioRxiv - Genetics 2020Quote: ... the PCR product were cloned into the pGEM-T vector (Promega) and sequenced with M13 reverse primer ...
-
bioRxiv - Genetics 2021Quote: ... allowing us to screen F1’s by PCR (Promega GoTaq mastermix) followed by restriction digests with AflII (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR analyses were performed using GoTaq DNA polymerase (#M7841, Promega) in a reaction volume of 25 μl comprising 1 μl of cDNA and primer pairs specific for the 5’-end (exon 1-3 ...
-
bioRxiv - Microbiology 2021Quote: ... Colony and screening PCRs were performed using GoTaq DNA polymerase (Promega; supplemented with 10% DMSO when screening B ...
-
bioRxiv - Developmental Biology 2020Quote: ... The resulting PCR product was digested with NotI (Promega, Cat#R6431) and XbaI (Promega ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was carried out using GoTaq Green Master Mix (Promega), following recommended protocol ...
-
bioRxiv - Microbiology 2020Quote: ... and analytic PCRs were performed using MasterMix (Promega, Madison, Wisconsin, USA) or Green MasterMix (BioTools ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was cloned into a pJET1.2 cloning vector (Promega) and further subcloned into the pYES2 yeast shuttle vector between BamH1 and Xba1 sites.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gel-purified (Wizard SV Gel and PCR Clean-Up System, Promega) and blunted using PfuUltra HF DNA polymerase (Agilent Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were ligated into pGEM-T easy (Promega, Madison, WI), excised by restriction enzyme digest ...