Labshake search
Citations for Promega :
651 - 700 of 1206 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and the amplified PCR products were ligated into the pGEM-T easy vector (Promega Madison, WI) for DNA sequence verification ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
The anti-lipidemic drug simvastatin modulates Epigenetic Biomarkers in the Amphipod Gammarus locustabioRxiv - Pharmacology and Toxicology 2020Quote: ... product identity was confirmed by cloning in pGEM®-T Easy Vector Systems (Promega Corporation, USA), followed by Sanger sequencing ...
-
bioRxiv - Microbiology 2020Quote: The respective pair of target locus homologous arms were cloned into pGEM-T Easy vector (Promega). Subsequently ...
-
bioRxiv - Biochemistry 2022Quote: HEK293 T cells were co-transfected with the target receptor construct and GloSensor cAMP reporter (Promega) in DMEM supplemented with 10% FBS for overnight incubation ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ARF3 coding region was amplified by RT-PCR and cloned into pGEM-T-easy (Promega). The resulting plasmid was digested with SpeI and transcribed with T7 RNA polymerase to generate the antisense probe ...
-
bioRxiv - Neuroscience 2021Quote: ... the Gbait-hsp70 fragment and QF2 fragment were independently inserted into pGEM T-easy (A1360, Promega) and subsequently combined into one vector by SacII digestion and ligation (Addgene ...
-
bioRxiv - Developmental Biology 2019Quote: ... purpuratus embryos and the 650 bp product was cloned using the pGEM-T Easy system (Promega). Protein expression was induced in E ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Plant Biology 2019Quote: ... HvSNF7.1 was ligated into the vector pGEM®-T Easy (#A1360, Promega, Madison, Wisconsin, United States). All the clones were verified by sequencing and finally cloned into the target vectors pGADT7 AD (#630442 ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA of GRXS17 (At4g04950) were inserted into the pGEM-T Easy plasmid (Promega, Madison, WI, USA). Different point mutations of cysteines to serines in GRXS17 were generated using QuikChange II Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Plant Biology 2019Quote: ... Enriched DNA fragments were amplified and cloned using the pGEM-T easy vector (Promega, Madison, USA) and transformed into XL1-BLUE Escherichia coli competent cells (Stratagene ...
-
bioRxiv - Genetics 2019Quote: ... The 5 kb CcMoY fragment was then cloned in the pGEM®-T Easy vector (Promega) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and MleKlfX were amplified from cDNA (Table 1) and cloned into pGEM-T Easy vector (Promega). The cloned fragments were used as templates for in vitro transcription (MEGAscript ...
-
bioRxiv - Immunology 2021Quote: ... and fibina were amplified from WT embryonic cDNA and cloned in pGEM®-T Easy (Promega). Primers used for each amplification are listed in Supplementary Methods (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting products were cloned into the pGEM-T Easy vector (Promega, Madison, WI, USA). After plasmid linearisation ...
-
bioRxiv - Cell Biology 2022Quote: ... the PkHSP70 5’UTR sequence was amplified and inserted into a pGem-T Easy vector (Promega) followed by the Cre60 sequence via restriction cloning between XhoI/KpnI sites ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was cloned into the pGEM-T Easy vector system (Promega, WI, USA) and then digested with the restriction enzymes ...
-
bioRxiv - Microbiology 2022Quote: ... A 666 bp fragment of MycFOLD-17 cDNA was amplified using the gene-specific primers MF17_ISH_F (ATGAGAATATTTTCGGCTCAA) and MF17_ISH_R (TCAGTCAGTTATCCAAGCAGC) and ligated into the pGEM-T Easy vector (Promega) and used as a template for in vitro transcription using the Digoxygenin (DIG ...
-
bioRxiv - Microbiology 2023Quote: The genes were cloned one by one into in pGEM-T Easy Vector (Promega, Madison, USA) and finally in pMG36e vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified DNA was ligated into a pGEM-T Easy pre-linearized vector (Promega, catalog no. A1360) and transformed into DH5α competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves from the amplification of the cloned target sequence in a pGEM-T vector (Promega) were used to quantify 16S total copy number per sample.
-
bioRxiv - Plant Biology 2023Quote: ... LSH3 and LSH4 were transcribed from pGEM®-T Easy with T7/SP6 RNA polymerase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The fused PCR fragment was then cloned into the pGEM-T Easy vector (Promega, Madison, WI) generating flgE::kan ...
-
bioRxiv - Biochemistry 2023Quote: ... reverse: ACT CTT GCT CTG GCT TGA TGA T) together with 2x GoTaq master mix (Promega) and commenced the reaction according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Luciferase activity was measured in purified CD8 T cell lysates with the luciferase assay system (Promega). Purified CD8 cells were lysed using cell lysis buffer 1X ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000), mouse anti-Alix (Abcam #ab117600 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Biochemistry 2020Quote: ... CaCl2·2H20 (0.99 g/L)) supplemented with 0.05% Tween 20 (Promega), 2.5 mM DTT ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000), anti-goat IgG (H+L ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-rabbit IgG (H+L) HRP conjugate (Promega #W4011, 1:10000).
-
bioRxiv - Synthetic Biology 2021Quote: ... was used to combine the two split EPG sections with N-Terminal HaloTag Plasmid PHTN (Promega) such that the N-terminal HaloTag sequence is preceded by the signal sequence at its 5’ end and succeeded by the rest of the EPG sequence at the 3’ end ...
-
bioRxiv - Cancer Biology 2024Quote: ... At the end of treatment cells were incubated O/N with CellTiterBlue reagent (Promega, cat. G8080). The day after ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg of reconstituted protein was digested in 0.05 N HCl with 1 µg pepsin (Promega) without prior reduction/alkylation at a volume of 200 µl 50 °C for 3 h ...
-
bioRxiv - Biochemistry 2024Quote: lrl 1μg of N-terminally FLAG-tagged receptor and 1μg of F22 (Promega, Cat. no: E2301) (for GloSensor assay)
-
bioRxiv - Plant Biology 2021Quote: The optimised HaloTag®-7 sequence (298 amino acids) from Promega (https://www.promega.de/) was genetically split on position 155/156 aa into the N-terminal fragment “NHalo” (aa 1-155 ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μl of premix [100 μM amino acid mixture minus methionine (Promega), 100 μM amino acid mixture minus leucine (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Plant Biology 2022Quote: ... All nucleotide sequences were amplified by PCR from PXO99A genomic DNA and cloned into pGEM-T (Promega). These intermediate constructs were verified by sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: ... and purified using a Nucleospin PCR clean-up kit and subcloned into p-GEM T-easy (Promega). Antisense RNA probes were synthesized using T3 ...
-
bioRxiv - Molecular Biology 2019Quote: The PCR product was first cloned into the pGEM®-T Easy vector (Promega Co. Cat #A1360) to facilitate the sequencing process and subcloning into the pET28a (+ ...
-
bioRxiv - Immunology 2019Quote: ... In vitro pmel-1 T cell-mediated cytotoxicity assay with CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega). protocols.io dx.doi.org/10.17504/protocols.io.6j4hcqw
-
bioRxiv - Genomics 2021Quote: ... Four µL of purified A-tailed PCR products were ligated to pGEM-T easy vector (Promega Corporation) and 5 µL of this ligated mixture was then transformed into DH5α competent cells (New England Biolab ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products with low concentration or bad sequencing quality were cloned into pGEM-T Easy Vector (Promega) for sequencing ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Bioengineering 2021Quote: ... A standard curve was prepared through cloning method using pGEM(R)-T Easy Vector System II (Promega) and JM109 Competent Cells (Promega) ...