Labshake search
Citations for Promega :
601 - 650 of 1580 citations for GATOR2 complex protein WDR24 WDR24 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were digested using a trypsin and lys-C mix (Promega, Madison, USA) at a ratio of 100:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequent protein digestion was performed using Endoproteinase LysC and Trypsin (Ref.: V5071, Promega), diluted 1:25 (enzyme to protein ...
-
bioRxiv - Systems Biology 2023Quote: ... The washed protein was then digested with trypsin (sequencing grade modified trypsin; Promega) in a mixture of 100 mM ammonium bicarbonate (pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2023Quote: ... RBD proteins in culture media were measured in Nano-Glo buffer (Promega N1110) supplemented with Nanoluciferase substrate and 11S protein according to the manual ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were then digested overnight at 37°C with Trypsin Gold (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2023Quote: ... and digestion of purified crosslinked protein with sequencing grade modified porcine trypsin (Promega), tryptic peptides were separated by reverse phase XSelect CSH C18 2.5 um resin (Waters ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were digested with Lys-C (Wako) and sequencing-grade trypsin (Promega, V5117) (1 μg of each in 20 μL of 50 mM TEAB ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro protein synthesis by the coupled transcription and translation (TnT) system (Promega) was carried out in the presence of 35S methionine in either wheat germ or rabbit reticulocyte lysates ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Cell Biology 2023Quote: ... the proteins were digested with 1 µg of trypsin/Lys-C mix (Promega) for 16 h at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... The proteins were proteolytically digested on the column by incubation with trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were expressed using TnT® Quick Coupled Transcription/Translation System (Promega L1170), according to manufacturer’s instructions and stored at -80°C.
-
bioRxiv - Immunology 2024Quote: ... and IgG captured and eluted from Magne Protein A beads (Promega, Madison, WI) as previously described 18,19 ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested with 0.8 µg/µL trypsin solution (proteomics grade trypsin, Promega). Peptides were then eluted in 65 µl Digestion buffer (50 mM TEAB pH 8.5) ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested using 0.005 µg/µl trypsin (sequencing grade modified trypsin; Promega) in 40 mM NH4HCO3/10% ACN at 4°C for 20 minutes followed by 16 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... HALO-TF protein was subsequently incubated with 10 ug of MagneHALO beads (Promega) for 1 hour rotating at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... In-solution on-bead digestion of proteins was performed using Immobilized trypsin (Promega, sample-enzyme solution ratio of 94 (v/v) ...
-
bioRxiv - Neuroscience 2024Quote: GDNF protein levels were measured with the GDNF Emax Immunoassay System (G7620, Promega), according to the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg of protein lysate was digested (trypsin 1/100, w/w; Promega) and purified using the SP3 protocol42 ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Physiology 2024Quote: ... Digestion was performed using LysC & Trypsin (Promega, 1:20 protease to protein ratio) for 1 hour (37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The HALO-fused CBF proteins were purified thanks to Magne HaloTag beads (Promega). A control sample corresponding to HaloTag protein alone was used (referred to as pIX-HALO empty) ...
-
bioRxiv - Plant Biology 2024Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fusion proteins were directly purified using Magne Halo Tag Beads (Promega, USA). HaloTag–transcription factor fusion proteins were incubated with an adaptor-ligated genomic DNA library ...
-
bioRxiv - Microbiology 2024Quote: ... trypsin digestion of extracted protein was performed with 1 g trypsin (Promega, USA) and incubated at 37°C overnight ...
-
bioRxiv - Biophysics 2024Quote: Proteins were translated in-vitro using the TnT Coupled Reticulocyte Lysate System (Promega). Constructs in a pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2024Quote: ... protein extracts were digested overnight with 1 µg of trypsin (Promega, Madison, Wisconsin) in a solution containing 10 mM Tris-HCl at pH 8.0 and 2 mM CaCl2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The protein was purified under native conditions using MagneGST Glutathione Particles (Promega, #V861A). After annealing two complementary oligonucleotides (5’-AAAATACGAGGTCAGTCGTCACCTTTGCTTGCCCAGTTGTTTACTTCGTTTAAA -3’ and 5’-AAATTTAAACGAAGTAAACAACTGGGCAAGCAAAGGTGACGACTGACCTCGTAT -3’ for the Meox upstream region ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Plant Biology 2020Quote: ... The target proteins were immunodecorated with primary antibodies and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibodies (Catalogue number: W4011, Promega) at a dilution ratio of 1:20.000 ...
-
bioRxiv - Microbiology 2020Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega, #W4021) used at a 1:10,000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Immunology 2020Quote: ... were used as primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies were from Promega (Rabbit W401B and Mouse W402B), and the substrate ECL was detected by Pierce ECL2 solution (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were revealed using species-appropriate HRP-conjugated secondary antibodies (anti-rabbit or anti-mouse IgG (1:5000, Promega), or anti-guinea pig IgG (1:5000 ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were then incubated overnight at 4°C with primary antibodies (mouse anti-LgBIT antibody at 1:750 dilution [Promega N7100] ...
-
bioRxiv - Cancer Biology 2021Quote: ... Appropriate HRP conjugate secondary antibodies were from Promega. Signal was detected using the ECL system (BioRAD ...
-
bioRxiv - Microbiology 2020Quote: ... antibodies and anti-mouse IgG-HRP (Promega, USA) conjugates as primary and secondary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Halo-tag (G9211) antibody was purchased from Promega. The C11orf53 antibody was produced in rabbit in house by using full-length C11orf53 recombinant protein as antigen.
-
bioRxiv - Molecular Biology 2022Quote: ... Secondary HRP-conjugated antibodies were purchased from Promega or GE Healthcare (anti-mouse Cat ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HaloTag monoclonal antibody were from Promega. Other commercially available antibodies used were anti-APP (mouse ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mouse anti-β-Gal antibody (Promega, Cat# Z3783) was used at 1:100 (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-Halo Tag antibody (G928A; Promega), and mouse monoclonal anti-GAPDH antibody (M171-3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Secondary antibodies: anti-rabbit IgG HRP conjugate (Promega, catalog no ...
-
bioRxiv - Physiology 2023Quote: ... HRP-conjugated anti-mouse antibodies (Promega, Cat#W4021) in TBST was added to membranes and rocked on a rotator for 1 hour at the room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... an antibody against HaloTag (G9211) was from Promega; an antibody against GFP (7.1/13.1 ...