Labshake search
Citations for Promega :
501 - 550 of 2791 citations for Mono 2 Ethyl 5 Hydroxyhexyl Phthalate 13C4 99% Dehp Metabolite Ix 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... followed by 100 ng Trypsin (Promega, Cat# V5111) overnight digestion at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1:100 Endurazine Luciferase live cell substrate (Promega) and depending on condition ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μL of CellTiter-Glo® reagent (Promega) was added ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μl of CellTiter-Glo 2.0 reagent (Promega) was added to each well and allowed to equilibrate to room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 µl of CellTiter-Glo reagent (Promega #G7570) was added to each well ...
-
bioRxiv - Biochemistry 2024Quote: ... 1:100 Endurazine Luciferase live cell substrate (Promega) were added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 μM amino acid mixture minus leucine (Promega), and 0.5 U/μl SUPERase•In RNase Inhibitor (Thermo Fisher Scientific)] and incubated for 1 h at 30°C ...
-
bioRxiv - Microbiology 2023Quote: ... combined with 100 uL BacTiter-Glo Reagent (Promega BacTiter-Glo™ Microbial Cell Viability Assay) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 100 μl of Luciferase Assay Reagent (Promega) was treated right before detection ...
-
bioRxiv - Biophysics 2023Quote: ... and 100 nM JF-549 HaloTag ligand (Promega) before the column binding step ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µL Luciferin Detection Reagent (Promega Cat #TM344) was added to all wells ...
-
bioRxiv - Immunology 2024Quote: ... permeabilized with 1% TRITON X-100/PBS (Promega) and blocked with 5% FBS/PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-Halo (1:100; G9211, Promega). Donkey secondary antibodies conjugated to Alexa Fluor 405/488/568/647 (Jackson ImmunoResearch or Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... Add 100 µl of Luciferase Assay reagent (Promega) to each well ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 μM amino acid mixture without leucine (Promega), and 1 U/ml ScriptGuard RNase inhibitor (CELLSCRIPT)] ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Immunology 2020Quote: ... Plates were washed four times with 100 μl/well of PBST and 100 μl/well of 3,3,′5,5-tetramethylbenzidine TMB (Promega, Madison, WI, USA) were added and incubated for 20 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20×103 cells were seeded in a 24-well plate and co-transfected using PEI with pGL3-Chaserr-reporter vector (100 ng) and psiCHECK-1 (100 ng, Promega, C8011). Firefly and Renilla expression were measured using Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Genetics 2022Quote: ... the collected lysates (5% of which were collected as input control) were incubated with 100 μM TASQs (or 100 μM biotin as control) and 90 μg of MagneSphere® beads (Promega) for 2 h at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... + P/S + 0.5μg/mL Puromycin + 16ng/mL rhFGF-basic (Promega G5071).
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...