Labshake search
Citations for Promega :
451 - 500 of 2791 citations for Mono 2 Ethyl 5 Hydroxyhexyl Phthalate 13C4 99% Dehp Metabolite Ix 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... followed by replacing 100 μl of culture media in each well with 100 μl CellTitre-Glo reagent (Promega #G7570). Luminescence was measured to quantify viable cells as described above.
-
bioRxiv - Microbiology 2022Quote: ... followed by replacing 100 μl of culture media in each well with 100 μl CellTitre-Glo reagent (Promega #G7570). Plates were covered with aluminum foil and placed on an orbital shaker to induce cell-lysis for 5 min ...
-
bioRxiv - Microbiology 2023Quote: RNA was incubated at 95°C for 2 min and on ice for 2 min before 3.3 x RNA folding buffer (100 mM HEPES pH 8.0, 100 mM NaCl and 10 mM MgCl2) and RNasin Plus RNase Inhibitor (Promega) was added to a final volume of 10 μl and incubated for 20 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... 100 μl of culture medium were discarded and addition with 100 μl of Bright-Glo luciferase reagent (Promega, E6120) in each well ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Immunology 2022Quote: ... 100 μl of ATP-depleted faecal suspension was mixed with 100 μl BacTiter-Glo™ Microbial Cell Viability Assay (Promega) in a clear ...
-
bioRxiv - Cell Biology 2023Quote: ... Double transfections were performed using 200 ng total DNA containing 100 ng of Fluc reporter vector and 100 ng of Renilla luciferase (Rluc) vector (pRL-TKl; Promega). After 4 hours of transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Cell Biology 2019Quote: ... The full-length coding sequence of murine Tmem98 was amplified from a mix of murine embryonic and murine keratinocyte cDNA using forward 5’-AAAAAGCTTGCCATGGAGACTGTGGTGATCGTC-3’ and reverse 5’-TTTTGAATTCTTAAATGGCCGACTGTTCCTGCAGGAAGC-3’ primers and cloned into pSP72 (Promega) as a HindIII/EcoRI fragment ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-β-galactosidase (Promega, Z378A; 1/100); mouse anti-Myc (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... β-III TUBULIN (mouse, 1:100 Promega catalogue # G7128), BLBP (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-III-tubulin 1:100 (Promega), rabbit anti-neurofilament-L 1:50 (Cell-Signaling Technology) ...
-
bioRxiv - Systems Biology 2019Quote: ... 100 μL of the NanoLuc substrate (Promega, #N1110) were added to each well ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μl ONE-Glo™ luciferase reagent (Promega) was added to each well for 3-min incubation at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... 100 μl ONE-Glo™ luciferase reagent (Promega) was added to each well for 3-min incubation at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 ng random hexamer (Cat # C1181, Promega) and heated to 70 °C for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... After adding 100 μl of TMB product (Promega) to each well ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μL of CellTiter-Glo 2.0 Reagent (Promega) was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μL One-Glo luciferase substrate solution (Promega) was added to each well prior to reading the signal on the Envision plate reader (Perkin Elmer).
-
bioRxiv - Cancer Biology 2022Quote: ... 100 μL CellTiter-Glo 2.0 reagent (Promega, #G9242) was mixed with the media ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM NaF and 100 µM luciferin (Promega)] to a final volume of 15 µl with water ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 μL LUC assay reagent (E1500 Kit; Promega) was added to 20 μL cell lysate into a luminometer tube ...
-
bioRxiv - Microbiology 2019Quote: ... and the 100-bp DNA step ladder (Promega). Both ladders were loaded at least 3 times in every agarose gel and used as reference to determine DNA fragment length.
-
bioRxiv - Neuroscience 2020Quote: ... Protein A/G magnetic beads (100 µL) (Promega) were washed with HB prior to addition to the RiboTag-IP fraction and were rotated at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... or 100 nM JF646 Halo linker (Promega: GA1120) for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and with 100 nM TMR HaloTag ligand (Promega). Following two PBS washes ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of CellTitre-Glo reagent (Promega #G7570) was then added to each well and luminescence was measured to quantify viable cells as described above.