Labshake search
Citations for Promega :
501 - 550 of 4304 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade C TV019 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and digestion with Trypsin and Lys-C (Trypsin/Lys-C Mix, Mass Spec Grade Promega) for 14 hours at 37° C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Physiology 2020Quote: ... oligo-dT primed cDNA was synthesized from 500 ng of total RNA using Murine Moloney Leukaemia Virus reverse transcriptase (Promega, USA). qRT-PCR was performed using a ViiA Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... the cell viability of each infected virus variants was measured using CellTiter 96 Aqueous One solution Cell Proliferation Assay (Promega, USA). The relative cell viability was calculated by normalizing the absorbance value of treated virus samples against untreated virus samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Microbiology 2022Quote: ... We performed duplicate serial dilutions using supernatants collected from the virus rescues and measured luciferase expression at each dilution using Bright-Glo Luciferase Assay System (Promega, E2610). Virus titers were calculated as relative light units (RLU ...
-
bioRxiv - Molecular Biology 2023Quote: ... Produced pseudoviruses were titrated on HEK-293T-ACE2 by performing duplicate serial dilutions and virus titers were measured 48 hours after infection using Bright-Glo Luciferase Assay System (Promega, E2610).
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated at 37 °C for two days and the nLuc activity from the virus replication was measured by using Nano-Glo® Luciferase Assay System (Promega) following the manufacturer’s protocol using a plate reader (HT4 Biotek) ...
-
bioRxiv - Immunology 2024Quote: ... The virus neutralization titers were determined by measuring the NLuc activity using the Nano-Glo Luciferase Assay System (Promega, Madison, WI) following the manufacturer’s conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were digested with 1 μg lysyl endopeptidase (LysC) (FUJIFILM Wako Pure Chemical Corporation) and 1 μg trypsin (Promega, Tokyo, Japan) overnight at 37°C on a shaking incubator ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The protein from lysed cells were digested in 1 µL 10ng/µL of trypsin/LysC (Promega) in 100mM TEAB (ProtiFi) ...
-
bioRxiv - Biophysics 2023Quote: ... the proteins were digested into tryptic peptides by incubation with 1□µg sequencing grade trypsin (Promega) overnight at 37□°C ...
-
bioRxiv - Neuroscience 2023Quote: ... After the sequential digestion with LysC and trypsin (Promega, each protease to protein ratio 1:80), beads were retained with a magnetic rack and samples were filtered with Costar Spin-X spin filters (0·22 µm cut-off ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg of reconstituted protein was digested in 0.05 N HCl with 1 µg pepsin (Promega) without prior reduction/alkylation at a volume of 200 µl 50 °C for 3 h ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested overnight at 37°C with a 2 μg Trypsin/Lys-C enzyme mix (Promega). The next day ...
-
bioRxiv - Biochemistry 2023Quote: ... A mixture of trypsin and Endo-Lys-C (Trypsin/Lys-C Mix, Mass Spec Grade, Promega) was used for digestion of the sample ...
-
bioRxiv - Biochemistry 2023Quote: ... A mixture of trypsin and Endo-Lys-C (Trypsin/Lys-C Mix, Mass Spec Grade, Promega) was used for digestion of the sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were then digested with LysC at 1ug/100ug protein (Promega) for 3 h at room temperature (RT ...
-
bioRxiv - Plant Biology 2020Quote: ... Fusion proteins were purified using MagnetHis™ protein purification system (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Proteins were precipitated through the addition of Protein Precipitation Solution (Promega) followed by vigorous vortexing ...
-
bioRxiv - Neuroscience 2021Quote: ... S7A–C using FuGene 6 (Promega). Two days after transfection ...
-
bioRxiv - Systems Biology 2022Quote: ... and Lys-C (VA1170) from Promega. The beads used here include Sero-Mag streptavidin magnetic beads (Cytivia) ...
-
bioRxiv - Biochemistry 2019Quote: ... and Arg-C were from Promega. Tris ...
-
bioRxiv - Systems Biology 2020Quote: ... Trypsin/Lys-C Mix enzyme (Promega) was then added to the beads for a 16-hour on-beads digestion at 37 °C in a ThermoMixer shaking at 1200 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 0.25 μg Lys-C protease (Promega) was added and incubated for 4 h at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and Lys-C (Promega, Cat# PI90307). In a 50 µL reaction solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pNLF1-C [CMV Hygro] (Promega) vectors using restriction cloning or the In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Sequential digestion with Lys-C (Promega) and trypsin (proteomic grade from porcine pancreas ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... ratio 50:1 (protein:rLysC) for 3h/37°C and then digested with Sequencing Grade Modified Trypsin (#V5111, Promega, France) ratio 50:1 (protein:trypsin ...
-
bioRxiv - Microbiology 2020Quote: ... Cytosine tails (C-tails) were added to 1 µg sheared DNA using terminal deoxynucleotidyl transferase (TdT, Promega, Madison, WI). Transposon containing fragments were amplified in a PCR containing DNA from the TdT reaction as template and primers specific to the ColE1 site on the 5’ end of the transposon ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were washed twice (3000 x g for 5 min at 4°C) and resuspended in RNAse-free PBS with 1% BSA and 0.5 U/ul RNase inhibitor (Cat. N2615, Promega). Cells were then used for the 10x Genomics Chromium Single Cell System (10x Genomics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were washed twice (3000 x g for 5 min at 4°C) and resuspended in RNAse-free PBS with 1% BSA and 0.5 U/ul RNase inhibitor (Cat. N2615, Promega). Cells were then used for the 10x Genomics Chromium Single Cell System (10x Genomics ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fujifilm) and then incubated for 8 h at 37 °C with sequence-grade trypsin (1□g; Promega, Madison, Wisconsin). Peptides were desalted on Ultra Micro Spin Columns C18 (The Nest Group Inc. ...
-
bioRxiv - Biochemistry 2021Quote: ... The next day the sample was further diluted to 1 M urea and 750 ng Glu-C (Promega, V1651) were added and incubated for another 8 hours at 37°C.
-
ARL3 Mediates BBSome Ciliary Turnover by Promoting Its Outward Diffusion through the Transition ZonebioRxiv - Cell Biology 2021Quote: ... Five micrograms of RNA were reverse transcribed at 42 °C for 1 h using M-MLV Reverse Transcriptase (Promega) and oligo(T)18 primers (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the sample was digested at 37 °C with sequencing-grade trypsin (Promega; 1:50 protease:protein w/w ratio) or at 25°C with Glu-C (Promega ...